Incidental Mutation 'R8366:Rbm20'
ID646198
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8366 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53850181 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 863 (T863I)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164202]
Predicted Effect
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: T238I

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164202
AA Change: T863I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: T863I

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik G A 11: 72,176,695 Q590* probably null Het
9130011E15Rik T C 19: 45,932,354 Y468C probably damaging Het
Adnp2 T C 18: 80,130,510 D228G probably damaging Het
Adrb2 T A 18: 62,178,704 Y350F probably benign Het
Agbl4 T C 4: 111,566,664 S296P probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ampd1 A T 3: 103,088,494 D240V probably damaging Het
Carmil2 A G 8: 105,693,075 S838G probably benign Het
Cdh23 A G 10: 60,325,020 F2056L probably benign Het
Cyp4x1 A T 4: 115,112,866 S381T probably benign Het
Ddx20 A G 3: 105,687,379 S17P probably benign Het
Dlgap4 C A 2: 156,700,774 Y32* probably null Het
Dmbt1 T C 7: 131,066,600 F529L unknown Het
Ei24 A G 9: 36,786,504 S117P possibly damaging Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Gcfc2 A G 6: 81,923,801 E32G probably benign Het
Lama1 T C 17: 67,818,704 I2952T Het
Mkrn3 A T 7: 62,419,795 S83T probably benign Het
Ncoa2 T A 1: 13,180,606 D284V probably damaging Het
Olfr1490 A G 19: 13,654,539 S37G probably damaging Het
Osmr T A 15: 6,820,954 T724S possibly damaging Het
Pex1 A G 5: 3,626,007 E825G probably benign Het
Ranbp6 A G 19: 29,811,899 L351P probably damaging Het
Rcbtb2 T C 14: 73,207,192 S506P probably benign Het
Rdh12 T A 12: 79,211,514 I105N probably damaging Het
Ror1 A G 4: 100,409,998 I299V possibly damaging Het
Rpap3 C T 15: 97,681,667 R488K probably benign Het
Rps6kb1 A C 11: 86,511,829 V346G probably damaging Het
Setd2 T C 9: 110,548,748 S544P probably damaging Het
Sis A T 3: 72,958,233 V162E probably damaging Het
Slc16a10 A G 10: 40,076,871 V209A probably benign Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Teddm2 G T 1: 153,850,829 H47N probably damaging Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Trmt10c C T 16: 56,034,063 R403Q probably benign Het
Vps11 A T 9: 44,355,755 Y394* probably null Het
Zscan10 G T 17: 23,609,978 R498L probably damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCATGTTTCTTTCTGAGCC -3'
(R):5'- CCACAGAGCTGTTTCTCCAGAG -3'

Sequencing Primer
(F):5'- TCTGAGCCTCAGTTCCCGAAG -3'
(R):5'- AGAGCTGTTTCTCCAGAGAGCAC -3'
Posted On2020-09-02