Incidental Mutation 'R8367:Ttll9'
ID646203
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8367 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 152994148 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 271 (H271N)
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably benign
Transcript: ENSMUST00000099197
AA Change: H271N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: H271N

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103155
AA Change: H271N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: H271N

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik A T 13: 70,883,977 E56V unknown Het
Abcb1a A G 5: 8,686,221 T205A probably benign Het
Aplp2 T C 9: 31,177,906 E93G probably damaging Het
Arpin T A 7: 79,929,638 N79I possibly damaging Het
Atg7 T A 6: 114,686,099 D225E probably benign Het
Cc2d2b A G 19: 40,765,975 M229V unknown Het
Cep295 C T 9: 15,334,530 V877I probably benign Het
Cmip C T 8: 117,436,871 P359L probably benign Het
Cyb5rl A G 4: 107,070,949 Y94C probably benign Het
Cyp19a1 A G 9: 54,180,259 I125T probably damaging Het
Cyp2c54 T G 19: 40,073,681 Q44P probably damaging Het
Cyp2c67 A T 19: 39,638,674 H237Q probably benign Het
Dlgap2 A T 8: 14,843,544 Y953F probably benign Het
Hgfac G T 5: 35,045,446 C430F probably damaging Het
Kdm4b T C 17: 56,355,875 W149R probably damaging Het
Krt23 C T 11: 99,492,889 W59* probably null Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrrc7 T A 3: 158,202,370 Q271L possibly damaging Het
Ltc4s C A 11: 50,236,684 R108L possibly damaging Het
Mcm3ap T C 10: 76,477,859 S596P possibly damaging Het
Myot A G 18: 44,337,099 T48A probably benign Het
Mypn G C 10: 63,135,760 P834A probably damaging Het
Olfr1076 C T 2: 86,508,681 S74L probably damaging Het
Olfr1155 T C 2: 87,943,097 N177S possibly damaging Het
Parp14 T C 16: 35,857,754 K615E probably benign Het
Pramel6 A C 2: 87,510,470 Q382P probably damaging Het
Prdx2 A G 8: 84,971,615 D145G probably damaging Het
Prune1 A G 3: 95,265,526 V76A probably benign Het
Sppl2b A T 10: 80,863,191 H198L probably benign Het
Uhrf1bp1l T A 10: 89,805,377 D803E probably damaging Het
Vmn2r59 C A 7: 42,011,823 R856M probably benign Het
Yeats2 C T 16: 20,222,825 T1155I probably damaging Het
Zbbx A G 3: 75,081,727 probably null Het
Zfp160 A G 17: 21,025,542 D118G probably benign Het
Zfp366 A G 13: 99,244,043 M549V possibly damaging Het
Zp3r A G 1: 130,598,873 S198P probably damaging Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152962487 unclassified probably benign
BB011:Ttll9 UTSW 2 152962487 unclassified probably benign
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7924:Ttll9 UTSW 2 152962487 unclassified probably benign
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGAATGAGGCCACTATTGGG -3'
(R):5'- TCCATCAGGGACATCTGAGG -3'

Sequencing Primer
(F):5'- CCACTATTGGGAGCAGGCAG -3'
(R):5'- GGCAAGTATCCTTCTGGT -3'
Posted On2020-09-02