Incidental Mutation 'R8367:Arpin'
ID646213
Institutional Source Beutler Lab
Gene Symbol Arpin
Ensembl Gene ENSMUSG00000039043
Gene Nameactin-related protein 2/3 complex inhibitor
Synonyms2610034B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8367 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79925361-79935359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79929638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 79 (N79I)
Ref Sequence ENSEMBL: ENSMUSP00000049440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048731
AA Change: N79I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049440
Gene: ENSMUSG00000039043
AA Change: N79I

DomainStartEndE-ValueType
Pfam:UPF0552 1 224 4e-110 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,442,497 probably null Het
8030423J24Rik A T 13: 70,883,977 E56V unknown Het
Abcb1a A G 5: 8,686,221 T205A probably benign Het
Aplp2 T C 9: 31,177,906 E93G probably damaging Het
Atg7 T A 6: 114,686,099 D225E probably benign Het
Cc2d2b A G 19: 40,765,975 M229V unknown Het
Cep295 C T 9: 15,334,530 V877I probably benign Het
Clca3a2 A T 3: 144,817,747 probably null Het
Cmip C T 8: 117,436,871 P359L probably benign Het
Cyb5rl A G 4: 107,070,949 Y94C probably benign Het
Cyp19a1 A G 9: 54,180,259 I125T probably damaging Het
Cyp2c54 T G 19: 40,073,681 Q44P probably damaging Het
Cyp2c67 A T 19: 39,638,674 H237Q probably benign Het
Dlgap2 A T 8: 14,843,544 Y953F probably benign Het
Hgfac G T 5: 35,045,446 C430F probably damaging Het
Kdm4b T C 17: 56,355,875 W149R probably damaging Het
Krt23 C T 11: 99,492,889 W59* probably null Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrrc7 T A 3: 158,202,370 Q271L possibly damaging Het
Ltc4s C A 11: 50,236,684 R108L possibly damaging Het
Mcm3ap T C 10: 76,477,859 S596P possibly damaging Het
Myot A G 18: 44,337,099 T48A probably benign Het
Mypn G C 10: 63,135,760 P834A probably damaging Het
Olfr1076 C T 2: 86,508,681 S74L probably damaging Het
Olfr1155 T C 2: 87,943,097 N177S possibly damaging Het
Parp14 T C 16: 35,857,754 K615E probably benign Het
Pramel6 A C 2: 87,510,470 Q382P probably damaging Het
Prdx2 A G 8: 84,971,615 D145G probably damaging Het
Prune1 A G 3: 95,265,526 V76A probably benign Het
Sppl2b A T 10: 80,863,191 H198L probably benign Het
Ttll9 C A 2: 152,994,148 H271N probably benign Het
Uhrf1bp1l T A 10: 89,805,377 D803E probably damaging Het
Vmn2r59 C A 7: 42,011,823 R856M probably benign Het
Yeats2 C T 16: 20,222,825 T1155I probably damaging Het
Zbbx A G 3: 75,081,727 probably null Het
Zfp160 A G 17: 21,025,542 D118G probably benign Het
Zfp366 A G 13: 99,244,043 M549V possibly damaging Het
Zp3r A G 1: 130,598,873 S198P probably damaging Het
Other mutations in Arpin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Arpin APN 7 79927675 missense probably benign 0.00
IGL01393:Arpin APN 7 79931840 missense possibly damaging 0.51
IGL02127:Arpin APN 7 79928193 missense probably benign 0.01
IGL02553:Arpin APN 7 79927647 missense possibly damaging 0.71
R2350:Arpin UTSW 7 79931805 nonsense probably null
R3821:Arpin UTSW 7 79929660 missense probably damaging 1.00
R3924:Arpin UTSW 7 79929687 missense probably benign 0.02
R5287:Arpin UTSW 7 79928249 missense probably damaging 1.00
R6353:Arpin UTSW 7 79935345 start gained probably benign
R7871:Arpin UTSW 7 79927715 missense probably damaging 1.00
R8211:Arpin UTSW 7 79935244 start codon destroyed probably damaging 1.00
R8350:Arpin UTSW 7 79931867 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCAAGTTATGCTAAGAATCCACTG -3'
(R):5'- ATCTGTCCAGCCTATGCAGC -3'

Sequencing Primer
(F):5'- TGCTAAGAATCCACTGTCAAGG -3'
(R):5'- CAGCCTATGCAGCAGGGTAG -3'
Posted On2020-09-02