Incidental Mutation 'R8367:Sppl2b'
ID646222
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R8367 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80863191 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 198 (H198L)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably benign
Transcript: ENSMUST00000035597
AA Change: H198L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: H198L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000219951
Predicted Effect probably benign
Transcript: ENSMUST00000220091
AA Change: H46L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G A 2: 152,442,497 probably null Het
8030423J24Rik A T 13: 70,883,977 E56V unknown Het
Abcb1a A G 5: 8,686,221 T205A probably benign Het
Aplp2 T C 9: 31,177,906 E93G probably damaging Het
Arpin T A 7: 79,929,638 N79I possibly damaging Het
Atg7 T A 6: 114,686,099 D225E probably benign Het
Cc2d2b A G 19: 40,765,975 M229V unknown Het
Cep295 C T 9: 15,334,530 V877I probably benign Het
Clca3a2 A T 3: 144,817,747 probably null Het
Cmip C T 8: 117,436,871 P359L probably benign Het
Cyb5rl A G 4: 107,070,949 Y94C probably benign Het
Cyp19a1 A G 9: 54,180,259 I125T probably damaging Het
Cyp2c54 T G 19: 40,073,681 Q44P probably damaging Het
Cyp2c67 A T 19: 39,638,674 H237Q probably benign Het
Dlgap2 A T 8: 14,843,544 Y953F probably benign Het
Hgfac G T 5: 35,045,446 C430F probably damaging Het
Kdm4b T C 17: 56,355,875 W149R probably damaging Het
Krt23 C T 11: 99,492,889 W59* probably null Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrrc7 T A 3: 158,202,370 Q271L possibly damaging Het
Ltc4s C A 11: 50,236,684 R108L possibly damaging Het
Mcm3ap T C 10: 76,477,859 S596P possibly damaging Het
Myot A G 18: 44,337,099 T48A probably benign Het
Mypn G C 10: 63,135,760 P834A probably damaging Het
Olfr1076 C T 2: 86,508,681 S74L probably damaging Het
Olfr1155 T C 2: 87,943,097 N177S possibly damaging Het
Parp14 T C 16: 35,857,754 K615E probably benign Het
Pramel6 A C 2: 87,510,470 Q382P probably damaging Het
Prdx2 A G 8: 84,971,615 D145G probably damaging Het
Prune1 A G 3: 95,265,526 V76A probably benign Het
Ttll9 C A 2: 152,994,148 H271N probably benign Het
Uhrf1bp1l T A 10: 89,805,377 D803E probably damaging Het
Vmn2r59 C A 7: 42,011,823 R856M probably benign Het
Yeats2 C T 16: 20,222,825 T1155I probably damaging Het
Zbbx A G 3: 75,081,727 probably null Het
Zfp160 A G 17: 21,025,542 D118G probably benign Het
Zfp366 A G 13: 99,244,043 M549V possibly damaging Het
Zp3r A G 1: 130,598,873 S198P probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CATCATCTTTGTCATGGCCGTG -3'
(R):5'- CAATGATCACGTAGACTGCGGG -3'

Sequencing Primer
(F):5'- TGAGTACAGCTGACTCCA -3'
(R):5'- TATGGCCCCTAGGTCCTTGG -3'
Posted On2020-09-02