Mutagenetix > Incidental Mutation

Incidental Mutation 'R8367:Sppl2b'

646222

Institutional Source

Beutler Lab

Gene Symbol

Sppl2b

Ensembl Gene

ENSMUSG00000035206

Gene Name

signal peptide peptidase like 2B

Synonyms

3110056O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R8367 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80855275-80868708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80863191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 198 (H198L)

Ref Sequence

ENSEMBL: ENSMUSP00000036289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]

AlphaFold

Q3TD49

Predicted Effect

probably benign
Transcript: ENSMUST00000035597
AA Change: H198L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: H198L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:PA	55	147	5.5e-14	PFAM
transmembrane domain	167	189	N/A	INTRINSIC
PSN	210	485	2.16e-113	SMART
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219951

Predicted Effect

probably benign
Transcript: ENSMUST00000220091
AA Change: H46L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.0636

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	A	2: 152,442,497		probably null	Het
8030423J24Rik	A	T	13: 70,883,977	E56V	unknown	Het
Abcb1a	A	G	5: 8,686,221	T205A	probably benign	Het
Aplp2	T	C	9: 31,177,906	E93G	probably damaging	Het
Arpin	T	A	7: 79,929,638	N79I	possibly damaging	Het
Atg7	T	A	6: 114,686,099	D225E	probably benign	Het
Cc2d2b	A	G	19: 40,765,975	M229V	unknown	Het
Cep295	C	T	9: 15,334,530	V877I	probably benign	Het
Clca3a2	A	T	3: 144,817,747		probably null	Het
Cmip	C	T	8: 117,436,871	P359L	probably benign	Het
Cyb5rl	A	G	4: 107,070,949	Y94C	probably benign	Het
Cyp19a1	A	G	9: 54,180,259	I125T	probably damaging	Het
Cyp2c54	T	G	19: 40,073,681	Q44P	probably damaging	Het
Cyp2c67	A	T	19: 39,638,674	H237Q	probably benign	Het
Dlgap2	A	T	8: 14,843,544	Y953F	probably benign	Het
Hgfac	G	T	5: 35,045,446	C430F	probably damaging	Het
Kdm4b	T	C	17: 56,355,875	W149R	probably damaging	Het
Krt23	C	T	11: 99,492,889	W59*	probably null	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Lrrc7	T	A	3: 158,202,370	Q271L	possibly damaging	Het
Ltc4s	C	A	11: 50,236,684	R108L	possibly damaging	Het
Mcm3ap	T	C	10: 76,477,859	S596P	possibly damaging	Het
Myot	A	G	18: 44,337,099	T48A	probably benign	Het
Mypn	G	C	10: 63,135,760	P834A	probably damaging	Het
Olfr1076	C	T	2: 86,508,681	S74L	probably damaging	Het
Olfr1155	T	C	2: 87,943,097	N177S	possibly damaging	Het
Parp14	T	C	16: 35,857,754	K615E	probably benign	Het
Pramel6	A	C	2: 87,510,470	Q382P	probably damaging	Het
Prdx2	A	G	8: 84,971,615	D145G	probably damaging	Het
Prune1	A	G	3: 95,265,526	V76A	probably benign	Het
Ttll9	C	A	2: 152,994,148	H271N	probably benign	Het
Uhrf1bp1l	T	A	10: 89,805,377	D803E	probably damaging	Het
Vmn2r59	C	A	7: 42,011,823	R856M	probably benign	Het
Yeats2	C	T	16: 20,222,825	T1155I	probably damaging	Het
Zbbx	A	G	3: 75,081,727		probably null	Het
Zfp160	A	G	17: 21,025,542	D118G	probably benign	Het
Zfp366	A	G	13: 99,244,043	M549V	possibly damaging	Het
Zp3r	A	G	1: 130,598,873	S198P	probably damaging	Het

Other mutations in Sppl2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Sppl2b	APN	10	80864094	missense	probably damaging	1.00
IGL01835:Sppl2b	APN	10	80865341	missense	probably damaging	0.99
IGL01836:Sppl2b	APN	10	80861386	missense	probably benign	0.00
IGL01964:Sppl2b	APN	10	80865386	critical splice donor site	probably null
IGL02376:Sppl2b	APN	10	80867598	nonsense	probably null
R1641:Sppl2b	UTSW	10	80865131	missense	probably damaging	0.96
R2228:Sppl2b	UTSW	10	80865617	missense	probably damaging	1.00
R3104:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R3106:Sppl2b	UTSW	10	80867491	missense	probably benign	0.00
R4350:Sppl2b	UTSW	10	80862726	missense	probably benign	0.12
R5146:Sppl2b	UTSW	10	80867640	makesense	probably null
R5698:Sppl2b	UTSW	10	80866045	splice site	probably null
R6969:Sppl2b	UTSW	10	80865125	missense	probably damaging	1.00
R7649:Sppl2b	UTSW	10	80867419	missense	probably benign	0.02
R8212:Sppl2b	UTSW	10	80865359	missense	probably damaging	1.00
R8263:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8265:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866068	frame shift	probably null
R8398:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8400:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8480:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8481:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8505:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8817:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8818:Sppl2b	UTSW	10	80866069	frame shift	probably null
R8832:Sppl2b	UTSW	10	80866069	frame shift	probably null
R9175:Sppl2b	UTSW	10	80862973	missense	probably benign
R9624:Sppl2b	UTSW	10	80863539	missense	probably benign	0.03
Z1176:Sppl2b	UTSW	10	80867425	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- CATCATCTTTGTCATGGCCGTG -3'
(R):5'- CAATGATCACGTAGACTGCGGG -3'

Sequencing Primer
(F):5'- TGAGTACAGCTGACTCCA -3'
(R):5'- TATGGCCCCTAGGTCCTTGG -3'

Posted On

2020-09-02