Incidental Mutation 'R8367:Cyp2c67'
ID646233
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8367 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39638674 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 237 (H237Q)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect probably benign
Transcript: ENSMUST00000067328
AA Change: H237Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: H237Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik A T 13: 70,883,977 E56V unknown Het
Abcb1a A G 5: 8,686,221 T205A probably benign Het
Aplp2 T C 9: 31,177,906 E93G probably damaging Het
Arpin T A 7: 79,929,638 N79I possibly damaging Het
Atg7 T A 6: 114,686,099 D225E probably benign Het
Cc2d2b A G 19: 40,765,975 M229V unknown Het
Cep295 C T 9: 15,334,530 V877I probably benign Het
Cmip C T 8: 117,436,871 P359L probably benign Het
Cyb5rl A G 4: 107,070,949 Y94C probably benign Het
Cyp19a1 A G 9: 54,180,259 I125T probably damaging Het
Cyp2c54 T G 19: 40,073,681 Q44P probably damaging Het
Dlgap2 A T 8: 14,843,544 Y953F probably benign Het
Hgfac G T 5: 35,045,446 C430F probably damaging Het
Kdm4b T C 17: 56,355,875 W149R probably damaging Het
Krt23 C T 11: 99,492,889 W59* probably null Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrrc7 T A 3: 158,202,370 Q271L possibly damaging Het
Ltc4s C A 11: 50,236,684 R108L possibly damaging Het
Mcm3ap T C 10: 76,477,859 S596P possibly damaging Het
Myot A G 18: 44,337,099 T48A probably benign Het
Mypn G C 10: 63,135,760 P834A probably damaging Het
Olfr1076 C T 2: 86,508,681 S74L probably damaging Het
Olfr1155 T C 2: 87,943,097 N177S possibly damaging Het
Parp14 T C 16: 35,857,754 K615E probably benign Het
Pramel6 A C 2: 87,510,470 Q382P probably damaging Het
Prdx2 A G 8: 84,971,615 D145G probably damaging Het
Prune1 A G 3: 95,265,526 V76A probably benign Het
Sppl2b A T 10: 80,863,191 H198L probably benign Het
Ttll9 C A 2: 152,994,148 H271N probably benign Het
Uhrf1bp1l T A 10: 89,805,377 D803E probably damaging Het
Vmn2r59 C A 7: 42,011,823 R856M probably benign Het
Yeats2 C T 16: 20,222,825 T1155I probably damaging Het
Zbbx A G 3: 75,081,727 probably null Het
Zfp160 A G 17: 21,025,542 D118G probably benign Het
Zfp366 A G 13: 99,244,043 M549V possibly damaging Het
Zp3r A G 1: 130,598,873 S198P probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACAAAATCACTCTGTTTCTCTCAG -3'
(R):5'- GGTTATTCAAACGTGTAGAACAGAG -3'

Sequencing Primer
(F):5'- TCTCTCAGACATTCCCACACATG -3'
(R):5'- ACACTCAAAAGATATGTGAGTGTG -3'
Posted On2020-09-02