Incidental Mutation 'R8368:1110034G24Rik'
ID646240
Institutional Source Beutler Lab
Gene Symbol 1110034G24Rik
Ensembl Gene ENSMUSG00000044991
Gene NameRIKEN cDNA 1110034G24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8368 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132686931-132751055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132750513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 160 (I160T)
Ref Sequence ENSEMBL: ENSMUSP00000057009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061891] [ENSMUST00000110132] [ENSMUST00000148271]
Predicted Effect probably benign
Transcript: ENSMUST00000061891
AA Change: I160T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057009
Gene: ENSMUSG00000044991
AA Change: I160T

DomainStartEndE-ValueType
Pfam:DUF4521 1 206 2.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110132
AA Change: I160T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105759
Gene: ENSMUSG00000044991
AA Change: I160T

DomainStartEndE-ValueType
Pfam:DUF4521 1 204 3.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148271
SMART Domains Protein: ENSMUSP00000118968
Gene: ENSMUSG00000044991

DomainStartEndE-ValueType
Pfam:DUF4521 1 156 6e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A T 15: 76,735,255 S710T probably damaging Het
Asb10 A C 5: 24,539,617 I193S probably benign Het
C2cd6 A G 1: 59,094,661 L67P probably benign Het
Ccdc14 T C 16: 34,723,372 L748P probably benign Het
Cers4 T G 8: 4,515,698 V48G probably benign Het
Chrna10 T C 7: 102,115,016 T54A probably benign Het
Dip2b T C 15: 100,154,243 S242P probably benign Het
Fam151a A G 4: 106,746,993 T325A probably benign Het
Gm10697 A G 3: 94,072,586 F20S probably damaging Het
Gm21190 A T 5: 15,524,850 S257T possibly damaging Het
Gm49368 T C 7: 128,114,749 S909P probably benign Het
Gm5150 C A 3: 15,990,738 V108F probably damaging Het
Gsdmc2 G A 15: 63,825,053 T423I probably damaging Het
Hsf2 T A 10: 57,512,145 C501S probably damaging Het
Igf1r A G 7: 68,187,048 N551D probably benign Het
Kctd3 G A 1: 188,972,207 T789I probably benign Het
Lad1 A G 1: 135,831,526 E474G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Magi3 A T 3: 104,095,063 probably null Het
Nrd1 A G 4: 109,013,698 D174G probably benign Het
Nrxn3 T A 12: 90,332,041 Y445* probably null Het
Otol1 A G 3: 70,027,866 Y397C probably damaging Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Pqlc1 T C 18: 80,291,658 S231P probably benign Het
Rad21l A G 2: 151,653,470 V431A probably benign Het
Rad50 A G 11: 53,683,328 L694S possibly damaging Het
Rasal1 A G 5: 120,671,550 S507G probably damaging Het
Ros1 T A 10: 52,064,737 D2162V probably damaging Het
Samd7 A T 3: 30,765,425 D441V probably damaging Het
Senp1 T C 15: 98,045,374 S623G probably damaging Het
Slc23a3 G T 1: 75,129,637 P313T probably damaging Het
Stab1 T C 14: 31,148,411 D1320G possibly damaging Het
Tinf2 T C 14: 55,679,573 T372A probably damaging Het
Trim45 A G 3: 100,923,356 T149A possibly damaging Het
Trim63 TGAGGAGGAGGAGGAGGAGGAG TGAGGAGGAGGAGGAGGAG 4: 134,327,706 probably benign Het
Unc13c C T 9: 73,930,788 S927N probably benign Het
Uqcrfs1 C A 13: 30,540,816 G247V probably damaging Het
Zfp143 A T 7: 110,083,248 N342I probably damaging Het
Other mutations in 1110034G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:1110034G24Rik APN 2 132691946 splice site probably benign
R0243:1110034G24Rik UTSW 2 132750639 missense probably benign 0.01
R1275:1110034G24Rik UTSW 2 132692095 missense probably benign
R2518:1110034G24Rik UTSW 2 132750527 missense probably damaging 0.99
R6903:1110034G24Rik UTSW 2 132750644 nonsense probably null
R7840:1110034G24Rik UTSW 2 132750590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTATGAAGCATTTGCCCATCCAC -3'
(R):5'- ATGCCAGAGAAGCCCACATG -3'

Sequencing Primer
(F):5'- ATCCACTGCCAGGCTCTG -3'
(R):5'- ATGTACCCATGGACTCTGGG -3'
Posted On2020-09-02