Incidental Mutation 'R8368:Fam151a'
ID646248
Institutional Source Beutler Lab
Gene Symbol Fam151a
Ensembl Gene ENSMUSG00000034871
Gene Namefamily with sequence simliarity 151, member A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8368 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location106733889-106748292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106746993 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 325 (T325A)
Ref Sequence ENSEMBL: ENSMUSP00000047860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541]
Predicted Effect probably benign
Transcript: ENSMUST00000047620
AA Change: T325A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871
AA Change: T325A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065253
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102762
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,750,513 I160T probably benign Het
Arhgap39 A T 15: 76,735,255 S710T probably damaging Het
Asb10 A C 5: 24,539,617 I193S probably benign Het
C2cd6 A G 1: 59,094,661 L67P probably benign Het
Ccdc14 T C 16: 34,723,372 L748P probably benign Het
Cers4 T G 8: 4,515,698 V48G probably benign Het
Chrna10 T C 7: 102,115,016 T54A probably benign Het
Dip2b T C 15: 100,154,243 S242P probably benign Het
Gm10697 A G 3: 94,072,586 F20S probably damaging Het
Gm21190 A T 5: 15,524,850 S257T possibly damaging Het
Gm49368 T C 7: 128,114,749 S909P probably benign Het
Gm5150 C A 3: 15,990,738 V108F probably damaging Het
Gsdmc2 G A 15: 63,825,053 T423I probably damaging Het
Hsf2 T A 10: 57,512,145 C501S probably damaging Het
Igf1r A G 7: 68,187,048 N551D probably benign Het
Kctd3 G A 1: 188,972,207 T789I probably benign Het
Lad1 A G 1: 135,831,526 E474G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Magi3 A T 3: 104,095,063 probably null Het
Nrd1 A G 4: 109,013,698 D174G probably benign Het
Nrxn3 T A 12: 90,332,041 Y445* probably null Het
Otol1 A G 3: 70,027,866 Y397C probably damaging Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Pqlc1 T C 18: 80,291,658 S231P probably benign Het
Rad21l A G 2: 151,653,470 V431A probably benign Het
Rad50 A G 11: 53,683,328 L694S possibly damaging Het
Rasal1 A G 5: 120,671,550 S507G probably damaging Het
Ros1 T A 10: 52,064,737 D2162V probably damaging Het
Samd7 A T 3: 30,765,425 D441V probably damaging Het
Senp1 T C 15: 98,045,374 S623G probably damaging Het
Slc23a3 G T 1: 75,129,637 P313T probably damaging Het
Stab1 T C 14: 31,148,411 D1320G possibly damaging Het
Tinf2 T C 14: 55,679,573 T372A probably damaging Het
Trim45 A G 3: 100,923,356 T149A possibly damaging Het
Trim63 TGAGGAGGAGGAGGAGGAGGAG TGAGGAGGAGGAGGAGGAG 4: 134,327,706 probably benign Het
Unc13c C T 9: 73,930,788 S927N probably benign Het
Uqcrfs1 C A 13: 30,540,816 G247V probably damaging Het
Zfp143 A T 7: 110,083,248 N342I probably damaging Het
Other mutations in Fam151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam151a APN 4 106747593 missense possibly damaging 0.56
IGL02095:Fam151a APN 4 106747875 missense probably damaging 1.00
IGL02170:Fam151a APN 4 106735598 critical splice donor site probably null
IGL02725:Fam151a APN 4 106748014 missense probably damaging 0.99
R0025:Fam151a UTSW 4 106748174 missense probably benign 0.16
R0114:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R0620:Fam151a UTSW 4 106747931 missense probably benign 0.06
R1345:Fam151a UTSW 4 106742294 missense probably damaging 0.99
R1482:Fam151a UTSW 4 106745679 missense probably damaging 1.00
R1965:Fam151a UTSW 4 106733915 unclassified probably benign
R2086:Fam151a UTSW 4 106735563 splice site probably null
R4078:Fam151a UTSW 4 106747757 missense probably benign 0.31
R4677:Fam151a UTSW 4 106748259 missense possibly damaging 0.72
R6110:Fam151a UTSW 4 106748198 missense probably damaging 0.98
R6188:Fam151a UTSW 4 106745499 missense possibly damaging 0.61
R6288:Fam151a UTSW 4 106748144 missense probably damaging 0.99
R6526:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R7298:Fam151a UTSW 4 106735528 missense possibly damaging 0.80
R7341:Fam151a UTSW 4 106735510 missense probably benign 0.00
R7363:Fam151a UTSW 4 106745484 missense probably damaging 1.00
R7573:Fam151a UTSW 4 106743305 missense probably damaging 1.00
R8503:Fam151a UTSW 4 106746180 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTCCTATTGAGGGAGTTGTGCC -3'
(R):5'- GCAAATGACAGACCTGTGGG -3'

Sequencing Primer
(F):5'- GGCCCAGTAAATTCTGTTGAATGTC -3'
(R):5'- ACCTGTGGGTGAGGGTAGC -3'
Posted On2020-09-02