Incidental Mutation 'R8368:Gm21190'
ID 646251
Institutional Source Beutler Lab
Gene Symbol Gm21190
Ensembl Gene ENSMUSG00000106445
Gene Name predicted gene, 21190
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R8368 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 15524456-15529222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15524850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 257 (S257T)
Ref Sequence ENSEMBL: ENSMUSP00000143589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000196384]
AlphaFold A0A0G2JGJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000196384
AA Change: S257T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143589
Gene: ENSMUSG00000106445
AA Change: S257T

DomainStartEndE-ValueType
Pfam:Takusan 50 134 7.3e-32 PFAM
low complexity region 234 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,750,513 I160T probably benign Het
Arhgap39 A T 15: 76,735,255 S710T probably damaging Het
Asb10 A C 5: 24,539,617 I193S probably benign Het
C2cd6 A G 1: 59,094,661 L67P probably benign Het
Ccdc14 T C 16: 34,723,372 L748P probably benign Het
Cers4 T G 8: 4,515,698 V48G probably benign Het
Chrna10 T C 7: 102,115,016 T54A probably benign Het
Dip2b T C 15: 100,154,243 S242P probably benign Het
Fam151a A G 4: 106,746,993 T325A probably benign Het
Gm10697 A G 3: 94,072,586 F20S probably damaging Het
Gm49368 T C 7: 128,114,749 S909P probably benign Het
Gm5150 C A 3: 15,990,738 V108F probably damaging Het
Gsdmc2 G A 15: 63,825,053 T423I probably damaging Het
Hsf2 T A 10: 57,512,145 C501S probably damaging Het
Igf1r A G 7: 68,187,048 N551D probably benign Het
Kctd3 G A 1: 188,972,207 T789I probably benign Het
Lad1 A G 1: 135,831,526 E474G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Magi3 A T 3: 104,095,063 probably null Het
Nrd1 A G 4: 109,013,698 D174G probably benign Het
Nrxn3 T A 12: 90,332,041 Y445* probably null Het
Otol1 A G 3: 70,027,866 Y397C probably damaging Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Pqlc1 T C 18: 80,291,658 S231P probably benign Het
Rad21l A G 2: 151,653,470 V431A probably benign Het
Rad50 A G 11: 53,683,328 L694S possibly damaging Het
Rasal1 A G 5: 120,671,550 S507G probably damaging Het
Ros1 T A 10: 52,064,737 D2162V probably damaging Het
Samd7 A T 3: 30,765,425 D441V probably damaging Het
Senp1 T C 15: 98,045,374 S623G probably damaging Het
Slc23a3 G T 1: 75,129,637 P313T probably damaging Het
Stab1 T C 14: 31,148,411 D1320G possibly damaging Het
Tinf2 T C 14: 55,679,573 T372A probably damaging Het
Trim45 A G 3: 100,923,356 T149A possibly damaging Het
Trim63 TGAGGAGGAGGAGGAGGAGGAG TGAGGAGGAGGAGGAGGAG 4: 134,327,706 probably benign Het
Unc13c C T 9: 73,930,788 S927N probably benign Het
Uqcrfs1 C A 13: 30,540,816 G247V probably damaging Het
Zfp143 A T 7: 110,083,248 N342I probably damaging Het
Other mutations in Gm21190
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5992:Gm21190 UTSW 5 15524851 missense probably damaging 0.97
R6656:Gm21190 UTSW 5 15525851 missense possibly damaging 0.79
R7345:Gm21190 UTSW 5 15527904 splice site probably null
R7658:Gm21190 UTSW 5 15527925 missense possibly damaging 0.48
R8093:Gm21190 UTSW 5 15525816 missense possibly damaging 0.48
R8504:Gm21190 UTSW 5 15525864 missense probably benign 0.02
Z1176:Gm21190 UTSW 5 15524894 missense probably benign 0.06
Z1176:Gm21190 UTSW 5 15524974 missense not run
Z1176:Gm21190 UTSW 5 15526580 missense probably benign
Z1177:Gm21190 UTSW 5 15524894 missense probably benign 0.06
Z1177:Gm21190 UTSW 5 15524974 missense not run
Z1177:Gm21190 UTSW 5 15525807 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTTAGCAGCACAGCCCTC -3'
(R):5'- TCAAGTACAGTTGAGGTGGTAG -3'

Sequencing Primer
(F):5'- AGCCCTCCAGCCTGCTG -3'
(R):5'- AGTAGCCTCACAGCTGCCATG -3'
Posted On 2020-09-02