Incidental Mutation 'R8369:Lrat'
ID 646285
Institutional Source Beutler Lab
Gene Symbol Lrat
Ensembl Gene ENSMUSG00000028003
Gene Name lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8369 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 82892579-82903973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82903558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 52 (E52G)
Ref Sequence ENSEMBL: ENSMUSP00000029632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029632]
AlphaFold Q9JI60
PDB Structure Crystal structure of HRASLS3/LRAT chimeric protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029632
AA Change: E52G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029632
Gene: ENSMUSG00000028003
AA Change: E52G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LRAT 43 174 1.4e-44 PFAM
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit retinol homeostasis abnormalities and are more susceptible to vitamin A deficiency or display impaired vision associated with abnormal retinol metabolism. Males have testicular hypoplasia/atrophy and reduced mature sperm counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T A 8: 84,010,998 H94L unknown Het
4932438A13Rik T A 3: 37,011,603 L9M Het
4932438H23Rik G A 16: 91,055,769 H160Y probably benign Het
Abcc4 T G 14: 118,627,457 I386L probably benign Het
Arap2 G A 5: 62,604,326 R1686* probably null Het
Arfgef3 A T 10: 18,589,729 I2122N probably benign Het
Arhgap44 A T 11: 65,059,854 D119E probably damaging Het
Atp2b2 C T 6: 113,813,786 probably null Het
Brinp1 A T 4: 68,798,699 L304Q possibly damaging Het
C2cd3 T C 7: 100,395,258 V349A probably benign Het
Ccdc93 T C 1: 121,477,868 Y347H probably damaging Het
Ccdc93 T G 1: 121,494,397 I534S probably benign Het
Cyb5r4 A T 9: 87,040,433 D165V probably benign Het
Cygb G A 11: 116,649,283 T180I probably benign Het
Cyp4f15 T A 17: 32,697,965 S285R probably benign Het
Daxx G T 17: 33,912,616 C433F probably damaging Het
Dcaf6 T C 1: 165,357,474 E483G probably damaging Het
Dennd1a T A 2: 38,048,754 I115F probably damaging Het
Dnajc5b A G 3: 19,610,632 D198G probably damaging Het
Ercc1 T A 7: 19,354,452 C243* probably null Het
Ermard T C 17: 15,053,298 F382L probably damaging Het
Fer1l4 C A 2: 156,019,760 G1879V probably benign Het
Focad T A 4: 88,232,668 H516Q unknown Het
Gcsam T A 16: 45,616,006 W51R probably damaging Het
Ikbkb A G 8: 22,691,081 V122A probably benign Het
Iqgap2 A T 13: 95,661,603 S1065T probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Krt24 A T 11: 99,282,708 C262* probably null Het
N4bp3 A G 11: 51,644,426 L312P probably damaging Het
Naxe T C 3: 88,056,687 T246A probably benign Het
Pcolce2 A T 9: 95,637,794 M1L probably benign Het
Slc7a6 G A 8: 106,193,164 A270T probably damaging Het
Sord T A 2: 122,246,495 I27K probably benign Het
Srek1ip1 A G 13: 104,834,290 E83G probably benign Het
Srgap3 A C 6: 112,722,818 N1090K probably benign Het
Sult2a6 A C 7: 14,253,402 probably null Het
Tacc2 T A 7: 130,622,158 I191N probably damaging Het
Thoc3 A G 13: 54,467,895 S119P probably damaging Het
Tirap A G 9: 35,188,756 S211P probably benign Het
Tle4 T C 19: 14,452,512 T632A probably benign Het
Tnfaip8l2 T A 3: 95,140,175 I126F probably benign Het
Txnrd1 A G 10: 82,874,646 T114A probably benign Het
Vmn2r14 A G 5: 109,221,476 L77P probably damaging Het
Wwc1 G A 11: 35,867,371 T716I probably damaging Het
Yod1 A G 1: 130,717,623 K47R probably benign Het
Zfhx2 A T 14: 55,066,744 M1261K probably benign Het
Zfhx3 T C 8: 108,856,816 I1105T possibly damaging Het
Zfp9 C A 6: 118,464,392 K436N probably damaging Het
Zfp979 T C 4: 147,613,091 H387R possibly damaging Het
Other mutations in Lrat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Lrat APN 3 82903349 missense probably damaging 0.99
R1445:Lrat UTSW 3 82903369 missense probably damaging 1.00
R1491:Lrat UTSW 3 82903342 missense probably benign 0.07
R1735:Lrat UTSW 3 82897110 missense probably benign 0.01
R2419:Lrat UTSW 3 82903685 missense probably damaging 1.00
R4446:Lrat UTSW 3 82896986 missense probably damaging 0.98
R5442:Lrat UTSW 3 82903220 missense probably damaging 1.00
R5495:Lrat UTSW 3 82896982 missense probably benign 0.00
R6255:Lrat UTSW 3 82903505 missense probably damaging 1.00
R6468:Lrat UTSW 3 82903492 missense probably damaging 1.00
R6909:Lrat UTSW 3 82903654 missense probably damaging 1.00
R7041:Lrat UTSW 3 82903448 missense probably benign 0.03
R7396:Lrat UTSW 3 82903283 nonsense probably null
Z1177:Lrat UTSW 3 82903490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGGCAAAGTCCTCTACTG -3'
(R):5'- GAGCTCACCTCGTACAGAACAG -3'

Sequencing Primer
(F):5'- GTGTCCACACGGATGCTAG -3'
(R):5'- TCGTACAGAACAGTTGCAGC -3'
Posted On 2020-09-02