Incidental Mutation 'R8369:Cyb5r4'
ID646305
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8369 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87040433 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
Predicted Effect probably benign
Transcript: ENSMUST00000168529
AA Change: D165V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872
AA Change: D165V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T A 8: 84,010,998 H94L unknown Het
4932438A13Rik T A 3: 37,011,603 L9M Het
4932438H23Rik G A 16: 91,055,769 H160Y probably benign Het
Abcc4 T G 14: 118,627,457 I386L probably benign Het
Arap2 G A 5: 62,604,326 R1686* probably null Het
Arfgef3 A T 10: 18,589,729 I2122N probably benign Het
Arhgap44 A T 11: 65,059,854 D119E probably damaging Het
Atp2b2 C T 6: 113,813,786 probably null Het
Brinp1 A T 4: 68,798,699 L304Q possibly damaging Het
C2cd3 T C 7: 100,395,258 V349A probably benign Het
Ccdc93 T C 1: 121,477,868 Y347H probably damaging Het
Ccdc93 T G 1: 121,494,397 I534S probably benign Het
Cygb G A 11: 116,649,283 T180I probably benign Het
Cyp4f15 T A 17: 32,697,965 S285R probably benign Het
Daxx G T 17: 33,912,616 C433F probably damaging Het
Dcaf6 T C 1: 165,357,474 E483G probably damaging Het
Dennd1a T A 2: 38,048,754 I115F probably damaging Het
Dnajc5b A G 3: 19,610,632 D198G probably damaging Het
Ercc1 T A 7: 19,354,452 C243* probably null Het
Ermard T C 17: 15,053,298 F382L probably damaging Het
Fer1l4 C A 2: 156,019,760 G1879V probably benign Het
Focad T A 4: 88,232,668 H516Q unknown Het
Gcsam T A 16: 45,616,006 W51R probably damaging Het
Ikbkb A G 8: 22,691,081 V122A probably benign Het
Iqgap2 A T 13: 95,661,603 S1065T probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Krt24 A T 11: 99,282,708 C262* probably null Het
Lrat T C 3: 82,903,558 E52G probably damaging Het
N4bp3 A G 11: 51,644,426 L312P probably damaging Het
Naxe T C 3: 88,056,687 T246A probably benign Het
Pcolce2 A T 9: 95,637,794 M1L probably benign Het
Slc7a6 G A 8: 106,193,164 A270T probably damaging Het
Sord T A 2: 122,246,495 I27K probably benign Het
Srek1ip1 A G 13: 104,834,290 E83G probably benign Het
Srgap3 A C 6: 112,722,818 N1090K probably benign Het
Sult2a6 A C 7: 14,253,402 probably null Het
Tacc2 T A 7: 130,622,158 I191N probably damaging Het
Thoc3 A G 13: 54,467,895 S119P probably damaging Het
Tirap A G 9: 35,188,756 S211P probably benign Het
Tle4 T C 19: 14,452,512 T632A probably benign Het
Tnfaip8l2 T A 3: 95,140,175 I126F probably benign Het
Txnrd1 A G 10: 82,874,646 T114A probably benign Het
Vmn2r14 A G 5: 109,221,476 L77P probably damaging Het
Wwc1 G A 11: 35,867,371 T716I probably damaging Het
Yod1 A G 1: 130,717,623 K47R probably benign Het
Zfhx2 A T 14: 55,066,744 M1261K probably benign Het
Zfhx3 T C 8: 108,856,816 I1105T possibly damaging Het
Zfp9 C A 6: 118,464,392 K436N probably damaging Het
Zfp979 T C 4: 147,613,091 H387R possibly damaging Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGGGAGAGAGTAAGCTTTTG -3'
(R):5'- ATAAATGAGGTACTGCAGTTCGTG -3'

Sequencing Primer
(F):5'- AAAATGCTGGTGACAAGGGTTTCTC -3'
(R):5'- GCAGTTCGTGCGCTAAGC -3'
Posted On2020-09-02