Incidental Mutation 'R8369:Pcolce2'
ID646306
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8369 (G1)
Quality Score157.009
Status Not validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 95637794 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498]
Predicted Effect probably benign
Transcript: ENSMUST00000015498
AA Change: M1L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354
AA Change: M1L

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T A 8: 84,010,998 H94L unknown Het
4932438A13Rik T A 3: 37,011,603 L9M Het
4932438H23Rik G A 16: 91,055,769 H160Y probably benign Het
Abcc4 T G 14: 118,627,457 I386L probably benign Het
Arap2 G A 5: 62,604,326 R1686* probably null Het
Arfgef3 A T 10: 18,589,729 I2122N probably benign Het
Arhgap44 A T 11: 65,059,854 D119E probably damaging Het
Atp2b2 C T 6: 113,813,786 probably null Het
Brinp1 A T 4: 68,798,699 L304Q possibly damaging Het
C2cd3 T C 7: 100,395,258 V349A probably benign Het
Ccdc93 T C 1: 121,477,868 Y347H probably damaging Het
Ccdc93 T G 1: 121,494,397 I534S probably benign Het
Cyb5r4 A T 9: 87,040,433 D165V probably benign Het
Cygb G A 11: 116,649,283 T180I probably benign Het
Cyp4f15 T A 17: 32,697,965 S285R probably benign Het
Daxx G T 17: 33,912,616 C433F probably damaging Het
Dcaf6 T C 1: 165,357,474 E483G probably damaging Het
Dennd1a T A 2: 38,048,754 I115F probably damaging Het
Dnajc5b A G 3: 19,610,632 D198G probably damaging Het
Ercc1 T A 7: 19,354,452 C243* probably null Het
Ermard T C 17: 15,053,298 F382L probably damaging Het
Fer1l4 C A 2: 156,019,760 G1879V probably benign Het
Focad T A 4: 88,232,668 H516Q unknown Het
Gcsam T A 16: 45,616,006 W51R probably damaging Het
Ikbkb A G 8: 22,691,081 V122A probably benign Het
Iqgap2 A T 13: 95,661,603 S1065T probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Krt24 A T 11: 99,282,708 C262* probably null Het
Lrat T C 3: 82,903,558 E52G probably damaging Het
N4bp3 A G 11: 51,644,426 L312P probably damaging Het
Naxe T C 3: 88,056,687 T246A probably benign Het
Slc7a6 G A 8: 106,193,164 A270T probably damaging Het
Sord T A 2: 122,246,495 I27K probably benign Het
Srek1ip1 A G 13: 104,834,290 E83G probably benign Het
Srgap3 A C 6: 112,722,818 N1090K probably benign Het
Sult2a6 A C 7: 14,253,402 probably null Het
Tacc2 T A 7: 130,622,158 I191N probably damaging Het
Thoc3 A G 13: 54,467,895 S119P probably damaging Het
Tirap A G 9: 35,188,756 S211P probably benign Het
Tle4 T C 19: 14,452,512 T632A probably benign Het
Tnfaip8l2 T A 3: 95,140,175 I126F probably benign Het
Txnrd1 A G 10: 82,874,646 T114A probably benign Het
Vmn2r14 A G 5: 109,221,476 L77P probably damaging Het
Wwc1 G A 11: 35,867,371 T716I probably damaging Het
Yod1 A G 1: 130,717,623 K47R probably benign Het
Zfhx2 A T 14: 55,066,744 M1261K probably benign Het
Zfhx3 T C 8: 108,856,816 I1105T possibly damaging Het
Zfp9 C A 6: 118,464,392 K436N probably damaging Het
Zfp979 T C 4: 147,613,091 H387R possibly damaging Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R0989:Pcolce2 UTSW 9 95638723 missense probably benign 0.00
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2287:Pcolce2 UTSW 9 95678405 nonsense probably null
R2922:Pcolce2 UTSW 9 95694714 missense probably damaging 1.00
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R6883:Pcolce2 UTSW 9 95678343 critical splice acceptor site probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R7949:Pcolce2 UTSW 9 95694635 missense probably benign 0.11
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8510:Pcolce2 UTSW 9 95681647 missense probably damaging 0.98
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACAAACGGGACATTCAGCCG -3'
(R):5'- AAGCATATTCAAGCGCTAAAGC -3'

Sequencing Primer
(F):5'- GACATTCAGCCGCCGCC -3'
(R):5'- CAAACCGCTGGGAGGCAAG -3'
Posted On2020-09-02