Incidental Mutation 'R8370:Miga2'
ID646329
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Namemitoguardin 2
SynonymsFam73b, R74766, 5730472N09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8370 (G1)
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location30364233-30385521 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAGAG to AAG at 30375743 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000116543] [ENSMUST00000140075]
Predicted Effect probably null
Transcript: ENSMUST00000077977
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100214
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116543
SMART Domains Protein: ENSMUSP00000135126
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 1 91 3.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140075
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,952 D18G probably benign Het
4921530L21Rik T C 14: 95,882,494 L229P probably damaging Het
Adamts5 A G 16: 85,899,993 V92A possibly damaging Het
Armc2 T A 10: 41,923,837 N675I possibly damaging Het
Cav1 A G 6: 17,339,294 H126R possibly damaging Het
Clca4b A G 3: 144,926,063 F227S probably damaging Het
Clec4a4 G A 6: 122,991,799 G41D probably damaging Het
Commd1 A T 11: 22,982,104 L51Q probably damaging Het
Dhx57 A T 17: 80,245,763 V1245D probably damaging Het
Ephb2 A G 4: 136,655,991 I925T possibly damaging Het
Eprs T A 1: 185,399,257 I700K probably damaging Het
Fry C A 5: 150,395,819 T983K probably damaging Het
Gm14325 T C 2: 177,832,592 I232M probably benign Het
Golgb1 A G 16: 36,912,317 H683R probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif9 C T 9: 110,488,613 R113C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Lama5 T C 2: 180,201,487 E489G possibly damaging Het
Lhb A G 7: 45,421,642 D97G probably damaging Het
Lrp1b T C 2: 40,998,105 D2381G Het
Mmp17 A G 5: 129,605,578 D427G probably damaging Het
Mrps18b T C 17: 35,912,362 I131V probably benign Het
Nav1 T A 1: 135,471,144 K567* probably null Het
Ncam1 T A 9: 49,557,131 R343* probably null Het
Nfrkb T A 9: 31,405,579 N591K probably damaging Het
Numb A T 12: 83,808,200 C117* probably null Het
Olfr1487 T A 19: 13,619,297 I2N probably damaging Het
Olfr522 A T 7: 140,162,768 Y61N probably damaging Het
Pfpl A T 19: 12,429,911 N509Y probably damaging Het
Prss58 C A 6: 40,895,424 G222C probably damaging Het
Ptx4 C A 17: 25,123,340 P263Q possibly damaging Het
Ribc2 T G 15: 85,143,288 H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Smchd1 G A 17: 71,394,913 T1028M probably benign Het
Srebf1 T C 11: 60,202,196 I806V probably benign Het
Trim14 A T 4: 46,523,711 L109Q probably damaging Het
Wdfy4 A T 14: 33,093,251 H1602Q Het
Zbtb48 A G 4: 152,021,287 probably null Het
Zranb3 T C 1: 127,967,933 E726G probably benign Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30367717 missense probably benign 0.04
IGL01353:Miga2 APN 2 30371233 critical splice donor site probably null
IGL01679:Miga2 APN 2 30378250 missense probably benign 0.07
IGL03113:Miga2 APN 2 30384010 missense possibly damaging 0.96
uncertain UTSW 2 30371196 missense probably benign 0.00
R0620:Miga2 UTSW 2 30381744 unclassified probably benign
R1698:Miga2 UTSW 2 30377997 missense probably damaging 1.00
R1729:Miga2 UTSW 2 30368968 missense probably damaging 1.00
R1994:Miga2 UTSW 2 30381988 missense probably damaging 1.00
R2377:Miga2 UTSW 2 30383990 nonsense probably null
R2891:Miga2 UTSW 2 30378294 splice site probably null
R2892:Miga2 UTSW 2 30378294 splice site probably null
R2893:Miga2 UTSW 2 30378294 splice site probably null
R3788:Miga2 UTSW 2 30371225 nonsense probably null
R4042:Miga2 UTSW 2 30367726 missense possibly damaging 0.87
R5214:Miga2 UTSW 2 30371196 missense probably benign 0.00
R5750:Miga2 UTSW 2 30371565 missense probably damaging 1.00
R5928:Miga2 UTSW 2 30368863 splice site probably benign
R6134:Miga2 UTSW 2 30371217 missense probably benign 0.00
R6209:Miga2 UTSW 2 30381662 missense probably damaging 1.00
R6860:Miga2 UTSW 2 30371163 missense probably benign 0.15
R7373:Miga2 UTSW 2 30382071 missense probably damaging 1.00
R7884:Miga2 UTSW 2 30371204 missense probably benign 0.02
R8371:Miga2 UTSW 2 30375743 frame shift probably null
R8374:Miga2 UTSW 2 30375743 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTCTTTTGGACCCAGAGC -3'
(R):5'- CGAGCCTCATCTTGCTTCAG -3'

Sequencing Primer
(F):5'- AGAGCTGGCTCCATTTCCTCAG -3'
(R):5'- CTGTCTGCCATTTTAAGGGAATACC -3'
Posted On2020-09-02