Incidental Mutation 'R0039:Eif3m'
ID64633
Institutional Source Beutler Lab
Gene Symbol Eif3m
Ensembl Gene ENSMUSG00000027170
Gene Nameeukaryotic translation initiation factor 3, subunit M
SynonymsGa17, Pcid1, Tango7
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0039 (G1)
Quality Score119
Status Not validated
Chromosome2
Chromosomal Location104999656-105017080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105005872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 209 (V209E)
Ref Sequence ENSEMBL: ENSMUSP00000028592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028592] [ENSMUST00000111110] [ENSMUST00000148476]
Predicted Effect probably damaging
Transcript: ENSMUST00000028592
AA Change: V209E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028592
Gene: ENSMUSG00000027170
AA Change: V209E

DomainStartEndE-ValueType
Blast:HDc 119 209 1e-12 BLAST
PINT 268 357 6.42e-26 SMART
low complexity region 358 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111110
AA Change: V77E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106739
Gene: ENSMUSG00000027170
AA Change: V77E

DomainStartEndE-ValueType
Blast:HDc 13 77 7e-8 BLAST
PINT 136 225 6.42e-26 SMART
low complexity region 226 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131266
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148476
AA Change: V26E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122339
Gene: ENSMUSG00000027170
AA Change: V26E

DomainStartEndE-ValueType
Blast:PINT 84 126 7e-25 BLAST
low complexity region 127 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit decreased body weight and altered organ weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Eif3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Eif3m APN 2 105012843 intron probably benign
IGL02661:Eif3m APN 2 105004969 missense probably damaging 0.98
IGL02932:Eif3m APN 2 105014869 missense probably damaging 1.00
R0373:Eif3m UTSW 2 105005000 missense probably benign 0.06
R1452:Eif3m UTSW 2 105006777 missense probably damaging 1.00
R1695:Eif3m UTSW 2 105016953 missense probably damaging 0.98
R1934:Eif3m UTSW 2 105001279 missense probably damaging 1.00
R2115:Eif3m UTSW 2 105006796 missense probably damaging 1.00
R2416:Eif3m UTSW 2 105013833 missense probably benign
R4610:Eif3m UTSW 2 105013288 missense probably benign 0.08
R4713:Eif3m UTSW 2 105006839 splice site probably null
R5373:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5374:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5725:Eif3m UTSW 2 105013841 missense probably damaging 0.97
R7996:Eif3m UTSW 2 105001349 missense probably benign 0.22
Z1088:Eif3m UTSW 2 105013256 missense probably damaging 1.00
Z1177:Eif3m UTSW 2 105001274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGCTGCTTCAGCATTTACG -3'
(R):5'- TGAGAACAGTGAGCTGTTGCATTCC -3'

Sequencing Primer
(F):5'- tcccctcccctctctctc -3'
(R):5'- CAGAGCACACCCTCAGTGAAATA -3'
Posted On2013-08-06