Incidental Mutation 'R8370:Mmp17'
ID 646337
Institutional Source Beutler Lab
Gene Symbol Mmp17
Ensembl Gene ENSMUSG00000029436
Gene Name matrix metallopeptidase 17
Synonyms membrane type-4 matrix metalloproteinase, MT4-MMP
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8370 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 129584169-129611099 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129605578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 427 (D427G)
Ref Sequence ENSEMBL: ENSMUSP00000031390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031390]
AlphaFold Q9R0S3
Predicted Effect probably damaging
Transcript: ENSMUST00000031390
AA Change: D427G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: D427G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:PG_binding_1 44 104 5e-15 PFAM
ZnMc 128 295 8.26e-47 SMART
low complexity region 308 320 N/A INTRINSIC
HX 340 384 3.17e-8 SMART
HX 389 432 2.59e-13 SMART
HX 435 481 6.39e-13 SMART
HX 483 527 1.1e-7 SMART
low complexity region 563 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,952 D18G probably benign Het
4921530L21Rik T C 14: 95,882,494 L229P probably damaging Het
Adamts5 A G 16: 85,899,993 V92A possibly damaging Het
Armc2 T A 10: 41,923,837 N675I possibly damaging Het
Cav1 A G 6: 17,339,294 H126R possibly damaging Het
Clca4b A G 3: 144,926,063 F227S probably damaging Het
Clec4a4 G A 6: 122,991,799 G41D probably damaging Het
Commd1 A T 11: 22,982,104 L51Q probably damaging Het
Dhx57 A T 17: 80,245,763 V1245D probably damaging Het
Ephb2 A G 4: 136,655,991 I925T possibly damaging Het
Eprs T A 1: 185,399,257 I700K probably damaging Het
Fry C A 5: 150,395,819 T983K probably damaging Het
Gm14325 T C 2: 177,832,592 I232M probably benign Het
Golgb1 A G 16: 36,912,317 H683R probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif9 C T 9: 110,488,613 R113C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Lama5 T C 2: 180,201,487 E489G possibly damaging Het
Lhb A G 7: 45,421,642 D97G probably damaging Het
Lrp1b T C 2: 40,998,105 D2381G Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mrps18b T C 17: 35,912,362 I131V probably benign Het
Nav1 T A 1: 135,471,144 K567* probably null Het
Ncam1 T A 9: 49,557,131 R343* probably null Het
Nfrkb T A 9: 31,405,579 N591K probably damaging Het
Numb A T 12: 83,808,200 C117* probably null Het
Olfr1487 T A 19: 13,619,297 I2N probably damaging Het
Olfr522 A T 7: 140,162,768 Y61N probably damaging Het
Pfpl A T 19: 12,429,911 N509Y probably damaging Het
Prss58 C A 6: 40,895,424 G222C probably damaging Het
Ptx4 C A 17: 25,123,340 P263Q possibly damaging Het
Ribc2 T G 15: 85,143,288 H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Smchd1 G A 17: 71,394,913 T1028M probably benign Het
Srebf1 T C 11: 60,202,196 I806V probably benign Het
Trim14 A T 4: 46,523,711 L109Q probably damaging Het
Wdfy4 A T 14: 33,093,251 H1602Q Het
Zbtb48 A G 4: 152,021,287 probably null Het
Zranb3 T C 1: 127,967,933 E726G probably benign Het
Other mutations in Mmp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mmp17 APN 5 129606408 missense probably benign 0.00
IGL01602:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01605:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01782:Mmp17 APN 5 129602141 missense probably damaging 1.00
IGL01986:Mmp17 APN 5 129596628 missense probably damaging 1.00
IGL02096:Mmp17 APN 5 129598688 nonsense probably null
IGL02160:Mmp17 APN 5 129595569 missense possibly damaging 0.91
IGL03075:Mmp17 APN 5 129595074 missense probably damaging 1.00
P0005:Mmp17 UTSW 5 129596631 missense probably benign 0.00
R0125:Mmp17 UTSW 5 129594582 missense possibly damaging 0.88
R0553:Mmp17 UTSW 5 129598670 missense probably benign 0.30
R1521:Mmp17 UTSW 5 129595088 splice site probably null
R1938:Mmp17 UTSW 5 129602126 missense probably damaging 1.00
R2151:Mmp17 UTSW 5 129605661 missense probably benign 0.01
R4908:Mmp17 UTSW 5 129605666 nonsense probably null
R4970:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5096:Mmp17 UTSW 5 129605563 missense probably damaging 1.00
R5112:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5178:Mmp17 UTSW 5 129595058 missense probably damaging 1.00
R5304:Mmp17 UTSW 5 129594614 missense probably null 0.89
R5341:Mmp17 UTSW 5 129602129 missense possibly damaging 0.50
R6341:Mmp17 UTSW 5 129601955 missense probably damaging 0.99
R6501:Mmp17 UTSW 5 129606405 missense probably benign 0.00
R7257:Mmp17 UTSW 5 129595633 missense probably benign 0.03
R7371:Mmp17 UTSW 5 129605772 missense probably null 0.98
R7546:Mmp17 UTSW 5 129596589 missense probably damaging 1.00
R8026:Mmp17 UTSW 5 129595084 critical splice donor site probably null
R8525:Mmp17 UTSW 5 129602207 missense probably damaging 1.00
R8708:Mmp17 UTSW 5 129595422 missense possibly damaging 0.67
R8803:Mmp17 UTSW 5 129598709 nonsense probably null
R8878:Mmp17 UTSW 5 129606314 missense probably damaging 1.00
R8882:Mmp17 UTSW 5 129601944 missense probably benign 0.00
R9399:Mmp17 UTSW 5 129594622 nonsense probably null
R9404:Mmp17 UTSW 5 129605677 missense possibly damaging 0.89
R9528:Mmp17 UTSW 5 129606328 missense probably benign 0.00
W0251:Mmp17 UTSW 5 129595527 missense probably benign 0.09
Y5377:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Y5380:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Z1177:Mmp17 UTSW 5 129595661 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGATGGGGTCACTACCTTGTC -3'
(R):5'- TCTACAGACAAGGAACATGCCG -3'

Sequencing Primer
(F):5'- TTGTCCTGCCACCTGGGTG -3'
(R):5'- CATGGCATCATCCAACATGCTGG -3'
Posted On 2020-09-02