Incidental Mutation 'R0039:Mroh8'
ID64634
Institutional Source Beutler Lab
Gene Symbol Mroh8
Ensembl Gene ENSMUSG00000074627
Gene Namemaestro heat-like repeat family member 8
Synonyms4922505G16Rik
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R0039 (G1)
Quality Score104
Status Not validated
Chromosome2
Chromosomal Location157208550-157279549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157229929 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 552 (H552R)
Ref Sequence ENSEMBL: ENSMUSP00000124362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000143663
AA Change: H552R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124362
Gene: ENSMUSG00000074627
AA Change: H552R

DomainStartEndE-ValueType
low complexity region 189 200 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
SCOP:d1qbkb_ 724 1024 8e-10 SMART
Meta Mutation Damage Score 0.1998 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Mroh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mroh8 APN 2 157216914 missense probably damaging 1.00
IGL00691:Mroh8 APN 2 157238307 splice site probably benign
IGL00708:Mroh8 APN 2 157220170 missense probably damaging 1.00
IGL01526:Mroh8 APN 2 157238312 splice site probably benign
IGL01992:Mroh8 APN 2 157213696 missense probably damaging 1.00
IGL02076:Mroh8 APN 2 157271962 critical splice donor site probably null
IGL02308:Mroh8 APN 2 157254973 missense probably damaging 1.00
IGL02592:Mroh8 APN 2 157216969 missense probably damaging 0.96
PIT4378001:Mroh8 UTSW 2 157228700 missense possibly damaging 0.73
PIT4449001:Mroh8 UTSW 2 157225534 missense probably damaging 1.00
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0107:Mroh8 UTSW 2 157225468 missense probably benign 0.01
R0511:Mroh8 UTSW 2 157229918 missense probably damaging 1.00
R0523:Mroh8 UTSW 2 157224036 missense probably damaging 1.00
R0619:Mroh8 UTSW 2 157265081 missense possibly damaging 0.69
R1222:Mroh8 UTSW 2 157241854 splice site probably benign
R1418:Mroh8 UTSW 2 157241854 splice site probably benign
R1430:Mroh8 UTSW 2 157269525 missense possibly damaging 0.69
R1458:Mroh8 UTSW 2 157221304 missense probably damaging 1.00
R1509:Mroh8 UTSW 2 157233205 missense probably benign 0.14
R1528:Mroh8 UTSW 2 157230055 missense probably damaging 1.00
R1703:Mroh8 UTSW 2 157271976 missense probably benign 0.01
R1795:Mroh8 UTSW 2 157269551 missense probably benign 0.16
R1982:Mroh8 UTSW 2 157271975 missense possibly damaging 0.52
R3922:Mroh8 UTSW 2 157222811 missense probably benign 0.03
R4024:Mroh8 UTSW 2 157256352 missense probably benign 0.32
R4030:Mroh8 UTSW 2 157213720 missense probably damaging 1.00
R4200:Mroh8 UTSW 2 157241810 missense probably benign 0.10
R4492:Mroh8 UTSW 2 157258040 missense probably damaging 1.00
R4900:Mroh8 UTSW 2 157228727 missense probably benign 0.05
R5396:Mroh8 UTSW 2 157228656 missense possibly damaging 0.92
R5464:Mroh8 UTSW 2 157221230 missense probably damaging 1.00
R6008:Mroh8 UTSW 2 157253064 missense probably benign 0.40
R6220:Mroh8 UTSW 2 157233163 missense probably benign
R6661:Mroh8 UTSW 2 157225627 missense probably benign
R7000:Mroh8 UTSW 2 157216977 missense probably benign 0.03
R7024:Mroh8 UTSW 2 157221263 missense probably benign
R7221:Mroh8 UTSW 2 157229917 missense probably benign 0.06
R7549:Mroh8 UTSW 2 157269572 missense probably benign 0.01
R7593:Mroh8 UTSW 2 157229947 missense probably damaging 1.00
R7604:Mroh8 UTSW 2 157269564 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTCTAGCAGCAACTTCAATGTAGGTCC -3'
(R):5'- TTTCAGGTGCCAGAAATAGTAGGTGTG -3'

Sequencing Primer
(F):5'- tctcctcccctcctctcc -3'
(R):5'- CCAGAAATAGTAGGTGTGATCTGTG -3'
Posted On2013-08-06