Incidental Mutation 'R8370:Commd1'
ID646349
Institutional Source Beutler Lab
Gene Symbol Commd1
Ensembl Gene ENSMUSG00000051355
Gene NameCOMM domain containing 1
SynonymsMurr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8370 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location22896136-22982382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22982104 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 51 (L51Q)
Ref Sequence ENSEMBL: ENSMUSP00000124719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057843] [ENSMUST00000071068] [ENSMUST00000159081] [ENSMUST00000160826]
Predicted Effect probably benign
Transcript: ENSMUST00000057843
SMART Domains Protein: ENSMUSP00000053606
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:HCaRG 44 238 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071068
AA Change: L50Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065079
Gene: ENSMUSG00000051355
AA Change: L50Q

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:HCaRG 57 89 2.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093270
AA Change: L27Q
SMART Domains Protein: ENSMUSP00000090958
Gene: ENSMUSG00000051355
AA Change: L27Q

DomainStartEndE-ValueType
Pfam:HCaRG 3 137 1.7e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159081
AA Change: L51Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124719
Gene: ENSMUSG00000051355
AA Change: L51Q

DomainStartEndE-ValueType
Pfam:HCaRG 12 184 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160826
SMART Domains Protein: ENSMUSP00000125609
Gene: ENSMUSG00000098650

DomainStartEndE-ValueType
Pfam:HCaRG 1 99 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COMMD1 is a regulator of copper homeostasis, sodium uptake, and NF-kappa-B (see MIM 164011) signaling (de Bie et al., 2005 [PubMed 16267171]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal with growth retardation, failure to turn, increased apoptosis in brain mesenchyme and defects in extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,952 D18G probably benign Het
4921530L21Rik T C 14: 95,882,494 L229P probably damaging Het
Adamts5 A G 16: 85,899,993 V92A possibly damaging Het
Armc2 T A 10: 41,923,837 N675I possibly damaging Het
Cav1 A G 6: 17,339,294 H126R possibly damaging Het
Clca4b A G 3: 144,926,063 F227S probably damaging Het
Clec4a4 G A 6: 122,991,799 G41D probably damaging Het
Dhx57 A T 17: 80,245,763 V1245D probably damaging Het
Ephb2 A G 4: 136,655,991 I925T possibly damaging Het
Eprs T A 1: 185,399,257 I700K probably damaging Het
Fry C A 5: 150,395,819 T983K probably damaging Het
Gm14325 T C 2: 177,832,592 I232M probably benign Het
Golgb1 A G 16: 36,912,317 H683R probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif9 C T 9: 110,488,613 R113C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Lama5 T C 2: 180,201,487 E489G possibly damaging Het
Lhb A G 7: 45,421,642 D97G probably damaging Het
Lrp1b T C 2: 40,998,105 D2381G Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mmp17 A G 5: 129,605,578 D427G probably damaging Het
Mrps18b T C 17: 35,912,362 I131V probably benign Het
Nav1 T A 1: 135,471,144 K567* probably null Het
Ncam1 T A 9: 49,557,131 R343* probably null Het
Nfrkb T A 9: 31,405,579 N591K probably damaging Het
Numb A T 12: 83,808,200 C117* probably null Het
Olfr1487 T A 19: 13,619,297 I2N probably damaging Het
Olfr522 A T 7: 140,162,768 Y61N probably damaging Het
Pfpl A T 19: 12,429,911 N509Y probably damaging Het
Prss58 C A 6: 40,895,424 G222C probably damaging Het
Ptx4 C A 17: 25,123,340 P263Q possibly damaging Het
Ribc2 T G 15: 85,143,288 H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Smchd1 G A 17: 71,394,913 T1028M probably benign Het
Srebf1 T C 11: 60,202,196 I806V probably benign Het
Trim14 A T 4: 46,523,711 L109Q probably damaging Het
Wdfy4 A T 14: 33,093,251 H1602Q Het
Zbtb48 A G 4: 152,021,287 probably null Het
Zranb3 T C 1: 127,967,933 E726G probably benign Het
Other mutations in Commd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Commd1 APN 11 22899981 missense probably damaging 1.00
IGL02275:Commd1 APN 11 22900017 missense probably damaging 1.00
R3702:Commd1 UTSW 11 22974057 missense probably damaging 1.00
R3763:Commd1 UTSW 11 22974102 missense probably benign 0.14
R7853:Commd1 UTSW 11 22956532 missense possibly damaging 0.61
R8353:Commd1 UTSW 11 22978503 intron probably benign
R8453:Commd1 UTSW 11 22978503 intron probably benign
Predicted Primers PCR Primer
(F):5'- CGTTATGTGTCCCTAAAACAAGG -3'
(R):5'- GCCTTTGCCAGCTTTTATGG -3'

Sequencing Primer
(F):5'- CCTAAAACAAGGGCGCAACAGAG -3'
(R):5'- AGCTTTTATGGCCCTTCTCGG -3'
Posted On2020-09-02