Mutagenetix > Incidental Mutation

Incidental Mutation 'R8370:Ribc2'

646356

Institutional Source

Beutler Lab

Gene Symbol

Ribc2

Ensembl Gene

ENSMUSG00000022431

Gene Name

RIB43A domain with coiled-coils 2

Synonyms

Trib, 4930579A10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R8370 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85132078-85144570 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 85143288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 323 (H323Q)

Ref Sequence

ENSEMBL: ENSMUSP00000023067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023067] [ENSMUST00000229238]

AlphaFold

Q9D4Q1

Predicted Effect

probably benign
Transcript: ENSMUST00000023067
AA Change: H323Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000023067
Gene: ENSMUSG00000022431
AA Change: H323Q

Domain	Start	End	E-Value	Type
Pfam:RIB43A	3	377	9.7e-147	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229238

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,743,952	D18G	probably benign	Het
4921530L21Rik	T	C	14: 95,882,494	L229P	probably damaging	Het
Adamts5	A	G	16: 85,899,993	V92A	possibly damaging	Het
Armc2	T	A	10: 41,923,837	N675I	possibly damaging	Het
Cav1	A	G	6: 17,339,294	H126R	possibly damaging	Het
Clca4b	A	G	3: 144,926,063	F227S	probably damaging	Het
Clec4a4	G	A	6: 122,991,799	G41D	probably damaging	Het
Commd1	A	T	11: 22,982,104	L51Q	probably damaging	Het
Dhx57	A	T	17: 80,245,763	V1245D	probably damaging	Het
Ephb2	A	G	4: 136,655,991	I925T	possibly damaging	Het
Eprs	T	A	1: 185,399,257	I700K	probably damaging	Het
Fry	C	A	5: 150,395,819	T983K	probably damaging	Het
Gm14325	T	C	2: 177,832,592	I232M	probably benign	Het
Golgb1	A	G	16: 36,912,317	H683R	probably benign	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Kif9	C	T	9: 110,488,613	R113C	probably damaging	Het
Klhl33	C	T	14: 50,892,232	R312Q	probably damaging	Het
Lama5	T	C	2: 180,201,487	E489G	possibly damaging	Het
Lhb	A	G	7: 45,421,642	D97G	probably damaging	Het
Lrp1b	T	C	2: 40,998,105	D2381G		Het
Miga2	AAGAG	AAG	2: 30,375,743		probably null	Het
Mmp17	A	G	5: 129,605,578	D427G	probably damaging	Het
Mrps18b	T	C	17: 35,912,362	I131V	probably benign	Het
Nav1	T	A	1: 135,471,144	K567*	probably null	Het
Ncam1	T	A	9: 49,557,131	R343*	probably null	Het
Nfrkb	T	A	9: 31,405,579	N591K	probably damaging	Het
Numb	A	T	12: 83,808,200	C117*	probably null	Het
Olfr1487	T	A	19: 13,619,297	I2N	probably damaging	Het
Olfr522	A	T	7: 140,162,768	Y61N	probably damaging	Het
Pfpl	A	T	19: 12,429,911	N509Y	probably damaging	Het
Prss58	C	A	6: 40,895,424	G222C	probably damaging	Het
Ptx4	C	A	17: 25,123,340	P263Q	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCGGGGGCGGC	7: 97,579,929		probably benign	Het
Smchd1	G	A	17: 71,394,913	T1028M	probably benign	Het
Srebf1	T	C	11: 60,202,196	I806V	probably benign	Het
Trim14	A	T	4: 46,523,711	L109Q	probably damaging	Het
Wdfy4	A	T	14: 33,093,251	H1602Q		Het
Zbtb48	A	G	4: 152,021,287		probably null	Het
Zranb3	T	C	1: 127,967,933	E726G	probably benign	Het

Other mutations in Ribc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02028:Ribc2	APN	15	85143335	missense	possibly damaging	0.95
IGL02816:Ribc2	APN	15	85132905	missense	probably damaging	0.99
IGL02830:Ribc2	APN	15	85132257	utr 5 prime	probably benign
IGL03336:Ribc2	APN	15	85132913	nonsense	probably null
IGL03350:Ribc2	APN	15	85135502	missense	probably damaging	1.00
R0583:Ribc2	UTSW	15	85132914	splice site	probably null
R3685:Ribc2	UTSW	15	85135334	missense	possibly damaging	0.89
R3943:Ribc2	UTSW	15	85135250	missense	probably benign	0.00
R3944:Ribc2	UTSW	15	85135250	missense	probably benign	0.00
R4758:Ribc2	UTSW	15	85141666	missense	probably damaging	1.00
R7234:Ribc2	UTSW	15	85135532	missense	probably benign	0.00
R7472:Ribc2	UTSW	15	85135245	missense	probably benign	0.33
R7567:Ribc2	UTSW	15	85143247	missense	probably damaging	0.98
R7653:Ribc2	UTSW	15	85141675	missense	probably benign	0.36
R8443:Ribc2	UTSW	15	85135260	missense	probably benign	0.00
R8971:Ribc2	UTSW	15	85132136	start gained	probably benign
R9072:Ribc2	UTSW	15	85137962	missense	probably damaging	0.97
R9073:Ribc2	UTSW	15	85137962	missense	probably damaging	0.97
R9760:Ribc2	UTSW	15	85143367	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CATTTTAGGGCAGGAAAGCAGC -3'
(R):5'- TGTGCTCCTCAGGCACATAG -3'

Sequencing Primer
(F):5'- GAAAGCAGCCAGGCCATGC -3'
(R):5'- CACATAGGTACACATGGCGACTTG -3'

Posted On

2020-09-02