Incidental Mutation 'R8370:Ribc2'
ID 646356
Institutional Source Beutler Lab
Gene Symbol Ribc2
Ensembl Gene ENSMUSG00000022431
Gene Name RIB43A domain with coiled-coils 2
Synonyms 4930579A10Rik, Trib
MMRRC Submission 067809-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8370 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 85016279-85028771 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 85027489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 323 (H323Q)
Ref Sequence ENSEMBL: ENSMUSP00000023067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023067] [ENSMUST00000229238]
AlphaFold Q9D4Q1
Predicted Effect probably benign
Transcript: ENSMUST00000023067
AA Change: H323Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023067
Gene: ENSMUSG00000022431
AA Change: H323Q

DomainStartEndE-ValueType
Pfam:RIB43A 3 377 9.7e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229238
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,696,881 (GRCm39) V92A possibly damaging Het
Armc2 T A 10: 41,799,833 (GRCm39) N675I possibly damaging Het
Cav1 A G 6: 17,339,293 (GRCm39) H126R possibly damaging Het
Ccdc202 T C 14: 96,119,930 (GRCm39) L229P probably damaging Het
Clca4b A G 3: 144,631,824 (GRCm39) F227S probably damaging Het
Clec4a4 G A 6: 122,968,758 (GRCm39) G41D probably damaging Het
Commd1 A T 11: 22,932,104 (GRCm39) L51Q probably damaging Het
Dhx57 A T 17: 80,553,192 (GRCm39) V1245D probably damaging Het
Ephb2 A G 4: 136,383,302 (GRCm39) I925T possibly damaging Het
Eprs1 T A 1: 185,131,454 (GRCm39) I700K probably damaging Het
Fry C A 5: 150,319,284 (GRCm39) T983K probably damaging Het
Gm14325 T C 2: 177,474,385 (GRCm39) I232M probably benign Het
Golgb1 A G 16: 36,732,679 (GRCm39) H683R probably benign Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kif9 C T 9: 110,317,681 (GRCm39) R113C probably damaging Het
Klhl33 C T 14: 51,129,689 (GRCm39) R312Q probably damaging Het
Lama5 T C 2: 179,843,280 (GRCm39) E489G possibly damaging Het
Lhb A G 7: 45,071,066 (GRCm39) D97G probably damaging Het
Lrp1b T C 2: 40,888,117 (GRCm39) D2381G Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mmp17 A G 5: 129,682,642 (GRCm39) D427G probably damaging Het
Mrps18b T C 17: 36,223,254 (GRCm39) I131V probably benign Het
Nav1 T A 1: 135,398,882 (GRCm39) K567* probably null Het
Ncam1 T A 9: 49,468,431 (GRCm39) R343* probably null Het
Nfrkb T A 9: 31,316,875 (GRCm39) N591K probably damaging Het
Numb A T 12: 83,854,974 (GRCm39) C117* probably null Het
Or5b123 T A 19: 13,596,661 (GRCm39) I2N probably damaging Het
Or6ae1 A T 7: 139,742,681 (GRCm39) Y61N probably damaging Het
Pfpl A T 19: 12,407,275 (GRCm39) N509Y probably damaging Het
Prss58 C A 6: 40,872,358 (GRCm39) G222C probably damaging Het
Ptx4 C A 17: 25,342,314 (GRCm39) P263Q possibly damaging Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,229,136 (GRCm39) probably benign Het
Smchd1 G A 17: 71,701,908 (GRCm39) T1028M probably benign Het
Spata31d1e T C 13: 59,891,766 (GRCm39) D18G probably benign Het
Srebf1 T C 11: 60,093,022 (GRCm39) I806V probably benign Het
Trim14 A T 4: 46,523,711 (GRCm39) L109Q probably damaging Het
Wdfy4 A T 14: 32,815,208 (GRCm39) H1602Q Het
Zbtb48 A G 4: 152,105,744 (GRCm39) probably null Het
Zranb3 T C 1: 127,895,670 (GRCm39) E726G probably benign Het
Other mutations in Ribc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Ribc2 APN 15 85,027,536 (GRCm39) missense possibly damaging 0.95
IGL02816:Ribc2 APN 15 85,017,106 (GRCm39) missense probably damaging 0.99
IGL02830:Ribc2 APN 15 85,016,458 (GRCm39) utr 5 prime probably benign
IGL03336:Ribc2 APN 15 85,017,114 (GRCm39) nonsense probably null
IGL03350:Ribc2 APN 15 85,019,703 (GRCm39) missense probably damaging 1.00
R0583:Ribc2 UTSW 15 85,017,115 (GRCm39) splice site probably null
R3685:Ribc2 UTSW 15 85,019,535 (GRCm39) missense possibly damaging 0.89
R3943:Ribc2 UTSW 15 85,019,451 (GRCm39) missense probably benign 0.00
R3944:Ribc2 UTSW 15 85,019,451 (GRCm39) missense probably benign 0.00
R4758:Ribc2 UTSW 15 85,025,867 (GRCm39) missense probably damaging 1.00
R7234:Ribc2 UTSW 15 85,019,733 (GRCm39) missense probably benign 0.00
R7472:Ribc2 UTSW 15 85,019,446 (GRCm39) missense probably benign 0.33
R7567:Ribc2 UTSW 15 85,027,448 (GRCm39) missense probably damaging 0.98
R7653:Ribc2 UTSW 15 85,025,876 (GRCm39) missense probably benign 0.36
R8443:Ribc2 UTSW 15 85,019,461 (GRCm39) missense probably benign 0.00
R8971:Ribc2 UTSW 15 85,016,337 (GRCm39) start gained probably benign
R9072:Ribc2 UTSW 15 85,022,163 (GRCm39) missense probably damaging 0.97
R9073:Ribc2 UTSW 15 85,022,163 (GRCm39) missense probably damaging 0.97
R9760:Ribc2 UTSW 15 85,027,568 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CATTTTAGGGCAGGAAAGCAGC -3'
(R):5'- TGTGCTCCTCAGGCACATAG -3'

Sequencing Primer
(F):5'- GAAAGCAGCCAGGCCATGC -3'
(R):5'- CACATAGGTACACATGGCGACTTG -3'
Posted On 2020-09-02