Mutagenetix > Incidental Mutation

Incidental Mutation 'R8370:Adamts5'

646358

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

067809-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R8370 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85899993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 92 (V92A)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023611
AA Change: V92A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: V92A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,743,952	D18G	probably benign	Het
4921530L21Rik	T	C	14: 95,882,494	L229P	probably damaging	Het
Armc2	T	A	10: 41,923,837	N675I	possibly damaging	Het
Cav1	A	G	6: 17,339,294	H126R	possibly damaging	Het
Clca4b	A	G	3: 144,926,063	F227S	probably damaging	Het
Clec4a4	G	A	6: 122,991,799	G41D	probably damaging	Het
Commd1	A	T	11: 22,982,104	L51Q	probably damaging	Het
Dhx57	A	T	17: 80,245,763	V1245D	probably damaging	Het
Ephb2	A	G	4: 136,655,991	I925T	possibly damaging	Het
Eprs	T	A	1: 185,399,257	I700K	probably damaging	Het
Fry	C	A	5: 150,395,819	T983K	probably damaging	Het
Gm14325	T	C	2: 177,832,592	I232M	probably benign	Het
Golgb1	A	G	16: 36,912,317	H683R	probably benign	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Kif9	C	T	9: 110,488,613	R113C	probably damaging	Het
Klhl33	C	T	14: 50,892,232	R312Q	probably damaging	Het
Lama5	T	C	2: 180,201,487	E489G	possibly damaging	Het
Lhb	A	G	7: 45,421,642	D97G	probably damaging	Het
Lrp1b	T	C	2: 40,998,105	D2381G		Het
Miga2	AAGAG	AAG	2: 30,375,743		probably null	Het
Mmp17	A	G	5: 129,605,578	D427G	probably damaging	Het
Mrps18b	T	C	17: 35,912,362	I131V	probably benign	Het
Nav1	T	A	1: 135,471,144	K567*	probably null	Het
Ncam1	T	A	9: 49,557,131	R343*	probably null	Het
Nfrkb	T	A	9: 31,405,579	N591K	probably damaging	Het
Numb	A	T	12: 83,808,200	C117*	probably null	Het
Olfr1487	T	A	19: 13,619,297	I2N	probably damaging	Het
Olfr522	A	T	7: 140,162,768	Y61N	probably damaging	Het
Pfpl	A	T	19: 12,429,911	N509Y	probably damaging	Het
Prss58	C	A	6: 40,895,424	G222C	probably damaging	Het
Ptx4	C	A	17: 25,123,340	P263Q	possibly damaging	Het
Ribc2	T	G	15: 85,143,288	H323Q	probably benign	Het
Rsf1	CGGCGGC	CGGCGGCGGGGGCGGC	7: 97,579,929		probably benign	Het
Smchd1	G	A	17: 71,394,913	T1028M	probably benign	Het
Srebf1	T	C	11: 60,202,196	I806V	probably benign	Het
Trim14	A	T	4: 46,523,711	L109Q	probably damaging	Het
Wdfy4	A	T	14: 33,093,251	H1602Q		Het
Zbtb48	A	G	4: 152,021,287		probably null	Het
Zranb3	T	C	1: 127,967,933	E726G	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
R9616:Adamts5	UTSW	16	85862786	missense	probably benign	0.34
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTAGAGTGTAGCGCGCATG -3'
(R):5'- GGATAAAACCAGGCAGCCTC -3'

Sequencing Primer
(F):5'- CGCATGCTTGACTGCAAAG -3'
(R):5'- GCCTCAGGCTGCAGCAG -3'

Posted On

2020-09-02