Incidental Mutation 'R0039:Rhbdl2'
ID 64636
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Name rhomboid like 2
Synonyms
MMRRC Submission 038333-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0039 (G1)
Quality Score 87
Status Not validated
Chromosome 4
Chromosomal Location 123681667-123723697 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123703822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 32 (N32K)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
AlphaFold A2AGA4
Predicted Effect probably benign
Transcript: ENSMUST00000053202
AA Change: N32K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: N32K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106204
AA Change: N32K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: N32K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150286
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,617,009 (GRCm39) E523V possibly damaging Het
Col18a1 T G 10: 76,913,002 (GRCm39) K744N probably damaging Het
Degs2 A T 12: 108,656,848 (GRCm39) Y283N probably damaging Het
Eif3m A T 2: 104,836,217 (GRCm39) V209E probably damaging Het
Esyt1 A G 10: 128,356,831 (GRCm39) V300A probably damaging Het
Gnaz A G 10: 74,850,866 (GRCm39) Y297C probably damaging Het
Lmtk2 G T 5: 144,103,205 (GRCm39) L321F probably damaging Het
Map3k10 A G 7: 27,357,523 (GRCm39) S752P possibly damaging Het
Mcoln2 C T 3: 145,889,316 (GRCm39) T374M probably damaging Het
Mroh8 T C 2: 157,071,849 (GRCm39) H552R possibly damaging Het
Rreb1 C T 13: 38,083,613 (GRCm39) T92M probably damaging Het
Specc1 A T 11: 61,920,195 (GRCm39) M32L probably damaging Het
Stk31 T C 6: 49,419,192 (GRCm39) W700R probably damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123,723,450 (GRCm39) missense probably benign
IGL02111:Rhbdl2 APN 4 123,716,630 (GRCm39) missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123,716,610 (GRCm39) missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123,723,463 (GRCm39) nonsense probably null
R1292:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123,720,665 (GRCm39) missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123,703,880 (GRCm39) missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123,720,694 (GRCm39) critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123,711,710 (GRCm39) nonsense probably null
R5303:Rhbdl2 UTSW 4 123,704,014 (GRCm39) intron probably benign
R5951:Rhbdl2 UTSW 4 123,708,120 (GRCm39) missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123,703,908 (GRCm39) missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123,708,049 (GRCm39) missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123,711,659 (GRCm39) missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123,711,658 (GRCm39) missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R8152:Rhbdl2 UTSW 4 123,718,711 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCTGATCCAATTTGGGGCCAC -3'
(R):5'- ACCTCAGCCAGACTGATGAGGATG -3'

Sequencing Primer
(F):5'- CAAAGTTTTCCAGAGAGTCCAG -3'
(R):5'- CCAGACTGATGAGGATGATGAAC -3'
Posted On 2013-08-06