Incidental Mutation 'R8370:Dhx57'
ID 646362
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 067809-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R8370 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80553192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1245 (V1245D)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: V1192D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V1192D

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: V1245D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V1245D

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,696,881 (GRCm39) V92A possibly damaging Het
Armc2 T A 10: 41,799,833 (GRCm39) N675I possibly damaging Het
Cav1 A G 6: 17,339,293 (GRCm39) H126R possibly damaging Het
Ccdc202 T C 14: 96,119,930 (GRCm39) L229P probably damaging Het
Clca4b A G 3: 144,631,824 (GRCm39) F227S probably damaging Het
Clec4a4 G A 6: 122,968,758 (GRCm39) G41D probably damaging Het
Commd1 A T 11: 22,932,104 (GRCm39) L51Q probably damaging Het
Ephb2 A G 4: 136,383,302 (GRCm39) I925T possibly damaging Het
Eprs1 T A 1: 185,131,454 (GRCm39) I700K probably damaging Het
Fry C A 5: 150,319,284 (GRCm39) T983K probably damaging Het
Gm14325 T C 2: 177,474,385 (GRCm39) I232M probably benign Het
Golgb1 A G 16: 36,732,679 (GRCm39) H683R probably benign Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kif9 C T 9: 110,317,681 (GRCm39) R113C probably damaging Het
Klhl33 C T 14: 51,129,689 (GRCm39) R312Q probably damaging Het
Lama5 T C 2: 179,843,280 (GRCm39) E489G possibly damaging Het
Lhb A G 7: 45,071,066 (GRCm39) D97G probably damaging Het
Lrp1b T C 2: 40,888,117 (GRCm39) D2381G Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mmp17 A G 5: 129,682,642 (GRCm39) D427G probably damaging Het
Mrps18b T C 17: 36,223,254 (GRCm39) I131V probably benign Het
Nav1 T A 1: 135,398,882 (GRCm39) K567* probably null Het
Ncam1 T A 9: 49,468,431 (GRCm39) R343* probably null Het
Nfrkb T A 9: 31,316,875 (GRCm39) N591K probably damaging Het
Numb A T 12: 83,854,974 (GRCm39) C117* probably null Het
Or5b123 T A 19: 13,596,661 (GRCm39) I2N probably damaging Het
Or6ae1 A T 7: 139,742,681 (GRCm39) Y61N probably damaging Het
Pfpl A T 19: 12,407,275 (GRCm39) N509Y probably damaging Het
Prss58 C A 6: 40,872,358 (GRCm39) G222C probably damaging Het
Ptx4 C A 17: 25,342,314 (GRCm39) P263Q possibly damaging Het
Ribc2 T G 15: 85,027,489 (GRCm39) H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,229,136 (GRCm39) probably benign Het
Smchd1 G A 17: 71,701,908 (GRCm39) T1028M probably benign Het
Spata31d1e T C 13: 59,891,766 (GRCm39) D18G probably benign Het
Srebf1 T C 11: 60,093,022 (GRCm39) I806V probably benign Het
Trim14 A T 4: 46,523,711 (GRCm39) L109Q probably damaging Het
Wdfy4 A T 14: 32,815,208 (GRCm39) H1602Q Het
Zbtb48 A G 4: 152,105,744 (GRCm39) probably null Het
Zranb3 T C 1: 127,895,670 (GRCm39) E726G probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGACTAAGGCTTGTCTGC -3'
(R):5'- TTTAAGAAGCAAGTAACACAACAGC -3'

Sequencing Primer
(F):5'- CTTTAGGGACAGACCGTGCTTC -3'
(R):5'- TCACAGGTTTGAGGCCAAC -3'
Posted On 2020-09-02