Incidental Mutation 'R8370:Dhx57'
ID 646362
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R8370 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80238304-80290476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80245763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1245 (V1245D)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: V1192D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V1192D

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: V1245D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V1245D

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,952 D18G probably benign Het
4921530L21Rik T C 14: 95,882,494 L229P probably damaging Het
Adamts5 A G 16: 85,899,993 V92A possibly damaging Het
Armc2 T A 10: 41,923,837 N675I possibly damaging Het
Cav1 A G 6: 17,339,294 H126R possibly damaging Het
Clca4b A G 3: 144,926,063 F227S probably damaging Het
Clec4a4 G A 6: 122,991,799 G41D probably damaging Het
Commd1 A T 11: 22,982,104 L51Q probably damaging Het
Ephb2 A G 4: 136,655,991 I925T possibly damaging Het
Eprs T A 1: 185,399,257 I700K probably damaging Het
Fry C A 5: 150,395,819 T983K probably damaging Het
Gm14325 T C 2: 177,832,592 I232M probably benign Het
Golgb1 A G 16: 36,912,317 H683R probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif9 C T 9: 110,488,613 R113C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Lama5 T C 2: 180,201,487 E489G possibly damaging Het
Lhb A G 7: 45,421,642 D97G probably damaging Het
Lrp1b T C 2: 40,998,105 D2381G Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mmp17 A G 5: 129,605,578 D427G probably damaging Het
Mrps18b T C 17: 35,912,362 I131V probably benign Het
Nav1 T A 1: 135,471,144 K567* probably null Het
Ncam1 T A 9: 49,557,131 R343* probably null Het
Nfrkb T A 9: 31,405,579 N591K probably damaging Het
Numb A T 12: 83,808,200 C117* probably null Het
Olfr1487 T A 19: 13,619,297 I2N probably damaging Het
Olfr522 A T 7: 140,162,768 Y61N probably damaging Het
Pfpl A T 19: 12,429,911 N509Y probably damaging Het
Prss58 C A 6: 40,895,424 G222C probably damaging Het
Ptx4 C A 17: 25,123,340 P263Q possibly damaging Het
Ribc2 T G 15: 85,143,288 H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Smchd1 G A 17: 71,394,913 T1028M probably benign Het
Srebf1 T C 11: 60,202,196 I806V probably benign Het
Trim14 A T 4: 46,523,711 L109Q probably damaging Het
Wdfy4 A T 14: 33,093,251 H1602Q Het
Zbtb48 A G 4: 152,021,287 probably null Het
Zranb3 T C 1: 127,967,933 E726G probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R8371:Dhx57 UTSW 17 80275490 missense probably benign 0.18
R8403:Dhx57 UTSW 17 80278289 missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80254424 missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80270365 critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80242094 missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80254388 missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80245701 missense probably benign 0.09
R9717:Dhx57 UTSW 17 80275018 missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGACTAAGGCTTGTCTGC -3'
(R):5'- TTTAAGAAGCAAGTAACACAACAGC -3'

Sequencing Primer
(F):5'- CTTTAGGGACAGACCGTGCTTC -3'
(R):5'- TCACAGGTTTGAGGCCAAC -3'
Posted On 2020-09-02