Mutagenetix > Incidental Mutation

Incidental Mutation 'R8370:Pfpl'

646363

Institutional Source

Beutler Lab

Gene Symbol

Pfpl

Ensembl Gene

ENSMUSG00000040065

Gene Name

pore forming protein-like

Synonyms

Epcs5, Epcs50

MMRRC Submission

Accession Numbers

Genbank: NM_019540; MGI: 1860266

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R8370 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12427905-12432110 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12429911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 509 (N509Y)

Ref Sequence

ENSEMBL: ENSMUSP00000126346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168148]

AlphaFold

Q5RKV8

Predicted Effect

probably damaging
Transcript: ENSMUST00000168148
AA Change: N509Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: N509Y

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MACPF	144	343	6.26e-33	SMART
transmembrane domain	643	665	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,743,952	D18G	probably benign	Het
4921530L21Rik	T	C	14: 95,882,494	L229P	probably damaging	Het
Adamts5	A	G	16: 85,899,993	V92A	possibly damaging	Het
Armc2	T	A	10: 41,923,837	N675I	possibly damaging	Het
Cav1	A	G	6: 17,339,294	H126R	possibly damaging	Het
Clca4b	A	G	3: 144,926,063	F227S	probably damaging	Het
Clec4a4	G	A	6: 122,991,799	G41D	probably damaging	Het
Commd1	A	T	11: 22,982,104	L51Q	probably damaging	Het
Dhx57	A	T	17: 80,245,763	V1245D	probably damaging	Het
Ephb2	A	G	4: 136,655,991	I925T	possibly damaging	Het
Eprs	T	A	1: 185,399,257	I700K	probably damaging	Het
Fry	C	A	5: 150,395,819	T983K	probably damaging	Het
Gm14325	T	C	2: 177,832,592	I232M	probably benign	Het
Golgb1	A	G	16: 36,912,317	H683R	probably benign	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Kif9	C	T	9: 110,488,613	R113C	probably damaging	Het
Klhl33	C	T	14: 50,892,232	R312Q	probably damaging	Het
Lama5	T	C	2: 180,201,487	E489G	possibly damaging	Het
Lhb	A	G	7: 45,421,642	D97G	probably damaging	Het
Lrp1b	T	C	2: 40,998,105	D2381G		Het
Miga2	AAGAG	AAG	2: 30,375,743		probably null	Het
Mmp17	A	G	5: 129,605,578	D427G	probably damaging	Het
Mrps18b	T	C	17: 35,912,362	I131V	probably benign	Het
Nav1	T	A	1: 135,471,144	K567*	probably null	Het
Ncam1	T	A	9: 49,557,131	R343*	probably null	Het
Nfrkb	T	A	9: 31,405,579	N591K	probably damaging	Het
Numb	A	T	12: 83,808,200	C117*	probably null	Het
Olfr1487	T	A	19: 13,619,297	I2N	probably damaging	Het
Olfr522	A	T	7: 140,162,768	Y61N	probably damaging	Het
Prss58	C	A	6: 40,895,424	G222C	probably damaging	Het
Ptx4	C	A	17: 25,123,340	P263Q	possibly damaging	Het
Ribc2	T	G	15: 85,143,288	H323Q	probably benign	Het
Rsf1	CGGCGGC	CGGCGGCGGGGGCGGC	7: 97,579,929		probably benign	Het
Smchd1	G	A	17: 71,394,913	T1028M	probably benign	Het
Srebf1	T	C	11: 60,202,196	I806V	probably benign	Het
Trim14	A	T	4: 46,523,711	L109Q	probably damaging	Het
Wdfy4	A	T	14: 33,093,251	H1602Q		Het
Zbtb48	A	G	4: 152,021,287		probably null	Het
Zranb3	T	C	1: 127,967,933	E726G	probably benign	Het

Other mutations in Pfpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pfpl	APN	19	12429645	missense	probably benign	0.00
IGL01298:Pfpl	APN	19	12428673	missense	possibly damaging	0.68
IGL01310:Pfpl	APN	19	12428610	missense	probably damaging	1.00
IGL02273:Pfpl	APN	19	12429963	missense	possibly damaging	0.96
IGL02532:Pfpl	APN	19	12428845	missense	probably damaging	1.00
IGL02611:Pfpl	APN	19	12430283	missense	probably benign
IGL02642:Pfpl	APN	19	12429743	missense	probably damaging	1.00
IGL02715:Pfpl	APN	19	12429781	nonsense	probably null
IGL03087:Pfpl	APN	19	12428877	missense	probably benign	0.06
IGL03223:Pfpl	APN	19	12430074	missense	probably damaging	1.00
IGL03253:Pfpl	APN	19	12430029	missense	probably damaging	0.99
pegged	UTSW	19	12429010	missense	probably damaging	1.00
D3080:Pfpl	UTSW	19	12428832	missense	probably damaging	0.98
R0276:Pfpl	UTSW	19	12429237	missense	probably damaging	1.00
R0433:Pfpl	UTSW	19	12429475	missense	probably damaging	1.00
R1004:Pfpl	UTSW	19	12430425	missense	probably benign	0.00
R1510:Pfpl	UTSW	19	12429696	missense	probably benign	0.31
R1759:Pfpl	UTSW	19	12429860	missense	probably damaging	1.00
R2009:Pfpl	UTSW	19	12429955	missense	possibly damaging	0.95
R2063:Pfpl	UTSW	19	12429873	missense	probably damaging	1.00
R2201:Pfpl	UTSW	19	12430479	missense	probably benign	0.01
R2656:Pfpl	UTSW	19	12430236	missense	probably benign
R2969:Pfpl	UTSW	19	12429543	missense	probably benign	0.00
R3003:Pfpl	UTSW	19	12430326	missense	possibly damaging	0.90
R3428:Pfpl	UTSW	19	12430313	missense	probably benign	0.37
R3904:Pfpl	UTSW	19	12430437	missense	probably benign	0.00
R4049:Pfpl	UTSW	19	12429689	missense	probably damaging	1.00
R4717:Pfpl	UTSW	19	12429254	missense	probably benign	0.07
R5343:Pfpl	UTSW	19	12428688	missense	probably damaging	0.99
R5804:Pfpl	UTSW	19	12429663	missense	probably benign	0.00
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6047:Pfpl	UTSW	19	12429233	missense	probably damaging	1.00
R6106:Pfpl	UTSW	19	12429461	missense	probably damaging	0.99
R6657:Pfpl	UTSW	19	12429926	missense	probably benign	0.36
R7467:Pfpl	UTSW	19	12428514	missense	probably damaging	1.00
R7720:Pfpl	UTSW	19	12429174	missense	probably benign	0.02
R8024:Pfpl	UTSW	19	12430206	missense	possibly damaging	0.94
R8730:Pfpl	UTSW	19	12428580	missense	probably damaging	1.00
R8974:Pfpl	UTSW	19	12428475	missense	probably damaging	1.00
R9147:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9148:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9248:Pfpl	UTSW	19	12429010	missense	probably damaging	1.00
R9283:Pfpl	UTSW	19	12428856	missense	probably damaging	1.00
R9542:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9560:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9561:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9663:Pfpl	UTSW	19	12430095	missense	probably damaging	1.00
R9670:Pfpl	UTSW	19	12429743	missense	probably damaging	1.00
R9721:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9722:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9723:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9759:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9761:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9762:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
Z1176:Pfpl	UTSW	19	12429941	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTTCAGAGTGGCCAAGG -3'
(R):5'- TGTAAAGACTCCAGCCTTGACAC -3'

Sequencing Primer
(F):5'- TGGCCAAGGCTGAAGTTAGCTC -3'
(R):5'- GTAGGACACTTGGCATCCATCAATG -3'

Posted On

2020-09-02