Incidental Mutation 'R8370:Pfpl'
ID 646363
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Name pore forming protein-like
Synonyms Epcs5, Epcs50
MMRRC Submission 067809-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8370 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12405290-12409474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12407275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 509 (N509Y)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
AlphaFold Q5RKV8
Predicted Effect probably damaging
Transcript: ENSMUST00000168148
AA Change: N509Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: N509Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,696,881 (GRCm39) V92A possibly damaging Het
Armc2 T A 10: 41,799,833 (GRCm39) N675I possibly damaging Het
Cav1 A G 6: 17,339,293 (GRCm39) H126R possibly damaging Het
Ccdc202 T C 14: 96,119,930 (GRCm39) L229P probably damaging Het
Clca4b A G 3: 144,631,824 (GRCm39) F227S probably damaging Het
Clec4a4 G A 6: 122,968,758 (GRCm39) G41D probably damaging Het
Commd1 A T 11: 22,932,104 (GRCm39) L51Q probably damaging Het
Dhx57 A T 17: 80,553,192 (GRCm39) V1245D probably damaging Het
Ephb2 A G 4: 136,383,302 (GRCm39) I925T possibly damaging Het
Eprs1 T A 1: 185,131,454 (GRCm39) I700K probably damaging Het
Fry C A 5: 150,319,284 (GRCm39) T983K probably damaging Het
Gm14325 T C 2: 177,474,385 (GRCm39) I232M probably benign Het
Golgb1 A G 16: 36,732,679 (GRCm39) H683R probably benign Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Kif9 C T 9: 110,317,681 (GRCm39) R113C probably damaging Het
Klhl33 C T 14: 51,129,689 (GRCm39) R312Q probably damaging Het
Lama5 T C 2: 179,843,280 (GRCm39) E489G possibly damaging Het
Lhb A G 7: 45,071,066 (GRCm39) D97G probably damaging Het
Lrp1b T C 2: 40,888,117 (GRCm39) D2381G Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mmp17 A G 5: 129,682,642 (GRCm39) D427G probably damaging Het
Mrps18b T C 17: 36,223,254 (GRCm39) I131V probably benign Het
Nav1 T A 1: 135,398,882 (GRCm39) K567* probably null Het
Ncam1 T A 9: 49,468,431 (GRCm39) R343* probably null Het
Nfrkb T A 9: 31,316,875 (GRCm39) N591K probably damaging Het
Numb A T 12: 83,854,974 (GRCm39) C117* probably null Het
Or5b123 T A 19: 13,596,661 (GRCm39) I2N probably damaging Het
Or6ae1 A T 7: 139,742,681 (GRCm39) Y61N probably damaging Het
Prss58 C A 6: 40,872,358 (GRCm39) G222C probably damaging Het
Ptx4 C A 17: 25,342,314 (GRCm39) P263Q possibly damaging Het
Ribc2 T G 15: 85,027,489 (GRCm39) H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,229,136 (GRCm39) probably benign Het
Smchd1 G A 17: 71,701,908 (GRCm39) T1028M probably benign Het
Spata31d1e T C 13: 59,891,766 (GRCm39) D18G probably benign Het
Srebf1 T C 11: 60,093,022 (GRCm39) I806V probably benign Het
Trim14 A T 4: 46,523,711 (GRCm39) L109Q probably damaging Het
Wdfy4 A T 14: 32,815,208 (GRCm39) H1602Q Het
Zbtb48 A G 4: 152,105,744 (GRCm39) probably null Het
Zranb3 T C 1: 127,895,670 (GRCm39) E726G probably benign Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12,407,009 (GRCm39) missense probably benign 0.00
IGL01298:Pfpl APN 19 12,406,037 (GRCm39) missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12,405,974 (GRCm39) missense probably damaging 1.00
IGL02273:Pfpl APN 19 12,407,327 (GRCm39) missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12,406,209 (GRCm39) missense probably damaging 1.00
IGL02611:Pfpl APN 19 12,407,647 (GRCm39) missense probably benign
IGL02642:Pfpl APN 19 12,407,107 (GRCm39) missense probably damaging 1.00
IGL02715:Pfpl APN 19 12,407,145 (GRCm39) nonsense probably null
IGL03087:Pfpl APN 19 12,406,241 (GRCm39) missense probably benign 0.06
IGL03223:Pfpl APN 19 12,407,438 (GRCm39) missense probably damaging 1.00
IGL03253:Pfpl APN 19 12,407,393 (GRCm39) missense probably damaging 0.99
pegged UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
D3080:Pfpl UTSW 19 12,406,196 (GRCm39) missense probably damaging 0.98
R0276:Pfpl UTSW 19 12,406,601 (GRCm39) missense probably damaging 1.00
R0433:Pfpl UTSW 19 12,406,839 (GRCm39) missense probably damaging 1.00
R1004:Pfpl UTSW 19 12,407,789 (GRCm39) missense probably benign 0.00
R1510:Pfpl UTSW 19 12,407,060 (GRCm39) missense probably benign 0.31
R1759:Pfpl UTSW 19 12,407,224 (GRCm39) missense probably damaging 1.00
R2009:Pfpl UTSW 19 12,407,319 (GRCm39) missense possibly damaging 0.95
R2063:Pfpl UTSW 19 12,407,237 (GRCm39) missense probably damaging 1.00
R2201:Pfpl UTSW 19 12,407,843 (GRCm39) missense probably benign 0.01
R2656:Pfpl UTSW 19 12,407,600 (GRCm39) missense probably benign
R2969:Pfpl UTSW 19 12,406,907 (GRCm39) missense probably benign 0.00
R3003:Pfpl UTSW 19 12,407,690 (GRCm39) missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12,407,677 (GRCm39) missense probably benign 0.37
R3904:Pfpl UTSW 19 12,407,801 (GRCm39) missense probably benign 0.00
R4049:Pfpl UTSW 19 12,407,053 (GRCm39) missense probably damaging 1.00
R4717:Pfpl UTSW 19 12,406,618 (GRCm39) missense probably benign 0.07
R5343:Pfpl UTSW 19 12,406,052 (GRCm39) missense probably damaging 0.99
R5804:Pfpl UTSW 19 12,407,027 (GRCm39) missense probably benign 0.00
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6047:Pfpl UTSW 19 12,406,597 (GRCm39) missense probably damaging 1.00
R6106:Pfpl UTSW 19 12,406,825 (GRCm39) missense probably damaging 0.99
R6657:Pfpl UTSW 19 12,407,290 (GRCm39) missense probably benign 0.36
R7467:Pfpl UTSW 19 12,405,878 (GRCm39) missense probably damaging 1.00
R7720:Pfpl UTSW 19 12,406,538 (GRCm39) missense probably benign 0.02
R8024:Pfpl UTSW 19 12,407,570 (GRCm39) missense possibly damaging 0.94
R8730:Pfpl UTSW 19 12,405,944 (GRCm39) missense probably damaging 1.00
R8974:Pfpl UTSW 19 12,405,839 (GRCm39) missense probably damaging 1.00
R9147:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9148:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9248:Pfpl UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
R9283:Pfpl UTSW 19 12,406,220 (GRCm39) missense probably damaging 1.00
R9542:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9560:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9561:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9663:Pfpl UTSW 19 12,407,459 (GRCm39) missense probably damaging 1.00
R9670:Pfpl UTSW 19 12,407,107 (GRCm39) missense probably damaging 1.00
R9721:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9722:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9723:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9759:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9761:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9762:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
Z1176:Pfpl UTSW 19 12,407,305 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTTCAGAGTGGCCAAGG -3'
(R):5'- TGTAAAGACTCCAGCCTTGACAC -3'

Sequencing Primer
(F):5'- TGGCCAAGGCTGAAGTTAGCTC -3'
(R):5'- GTAGGACACTTGGCATCCATCAATG -3'
Posted On 2020-09-02