Mutagenetix > Incidental Mutation

Incidental Mutation 'R0039:Lmtk2'

64637

Institutional Source

Beutler Lab

Gene Symbol

Lmtk2

Ensembl Gene

ENSMUSG00000038970

Gene Name

lemur tyrosine kinase 2

Synonyms

BREK, AATYK2, A330101P12Rik, KPI2, KPI-2, 2900041G10Rik, cprk

MMRRC Submission

038333-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R0039 (G1)

Quality Score

107

Status

Not validated

Chromosome

Chromosomal Location

144037254-144125022 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 144103205 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 321 (L321F)

Ref Sequence

ENSEMBL: ENSMUSP00000048238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041804]

AlphaFold

Q3TYD6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041804
AA Change: L321F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: L321F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	42	61	N/A	INTRINSIC
low complexity region	72	88	N/A	INTRINSIC
STYKc	136	406	3.4e-39	SMART
low complexity region	924	953	N/A	INTRINSIC
low complexity region	1019	1035	N/A	INTRINSIC
low complexity region	1104	1117	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1354	1367	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atic	A	T	1: 71,617,009 (GRCm39)	E523V	possibly damaging	Het
Col18a1	T	G	10: 76,913,002 (GRCm39)	K744N	probably damaging	Het
Degs2	A	T	12: 108,656,848 (GRCm39)	Y283N	probably damaging	Het
Eif3m	A	T	2: 104,836,217 (GRCm39)	V209E	probably damaging	Het
Esyt1	A	G	10: 128,356,831 (GRCm39)	V300A	probably damaging	Het
Gnaz	A	G	10: 74,850,866 (GRCm39)	Y297C	probably damaging	Het
Map3k10	A	G	7: 27,357,523 (GRCm39)	S752P	possibly damaging	Het
Mcoln2	C	T	3: 145,889,316 (GRCm39)	T374M	probably damaging	Het
Mroh8	T	C	2: 157,071,849 (GRCm39)	H552R	possibly damaging	Het
Rhbdl2	T	A	4: 123,703,822 (GRCm39)	N32K	probably benign	Het
Rreb1	C	T	13: 38,083,613 (GRCm39)	T92M	probably damaging	Het
Specc1	A	T	11: 61,920,195 (GRCm39)	M32L	probably damaging	Het
Stk31	T	C	6: 49,419,192 (GRCm39)	W700R	probably damaging	Het

Other mutations in Lmtk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmtk2	APN	5	144,070,973 (GRCm39)	missense	probably damaging	1.00
IGL00496:Lmtk2	APN	5	144,111,512 (GRCm39)	missense	probably benign
IGL00848:Lmtk2	APN	5	144,113,216 (GRCm39)	missense	probably benign
IGL01450:Lmtk2	APN	5	144,111,520 (GRCm39)	missense	probably benign	0.03
IGL01833:Lmtk2	APN	5	144,112,753 (GRCm39)	nonsense	probably null
IGL01967:Lmtk2	APN	5	144,119,597 (GRCm39)	missense	probably benign
IGL01998:Lmtk2	APN	5	144,112,883 (GRCm39)	missense	probably damaging	1.00
IGL02106:Lmtk2	APN	5	144,112,769 (GRCm39)	missense	probably benign	0.03
IGL02147:Lmtk2	APN	5	144,093,754 (GRCm39)	missense	possibly damaging	0.78
IGL02581:Lmtk2	APN	5	144,085,166 (GRCm39)	missense	probably damaging	1.00
madagascar	UTSW	5	144,111,737 (GRCm39)	missense	probably benign	0.02
A4554:Lmtk2	UTSW	5	144,103,135 (GRCm39)	missense	possibly damaging	0.82
R0039:Lmtk2	UTSW	5	144,103,205 (GRCm39)	missense	probably damaging	1.00
R0108:Lmtk2	UTSW	5	144,111,103 (GRCm39)	missense	possibly damaging	0.78
R0367:Lmtk2	UTSW	5	144,111,103 (GRCm39)	missense	possibly damaging	0.78
R0515:Lmtk2	UTSW	5	144,111,809 (GRCm39)	missense	possibly damaging	0.77
R1434:Lmtk2	UTSW	5	144,111,407 (GRCm39)	missense	probably damaging	1.00
R1617:Lmtk2	UTSW	5	144,110,680 (GRCm39)	missense	probably damaging	1.00
R1760:Lmtk2	UTSW	5	144,110,993 (GRCm39)	missense	probably damaging	0.99
R1785:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R1786:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R1907:Lmtk2	UTSW	5	144,111,928 (GRCm39)	missense	probably benign	0.00
R2130:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R2131:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R2132:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R2133:Lmtk2	UTSW	5	144,111,806 (GRCm39)	missense	possibly damaging	0.61
R2140:Lmtk2	UTSW	5	144,084,433 (GRCm39)	missense	probably damaging	1.00
R2141:Lmtk2	UTSW	5	144,084,433 (GRCm39)	missense	probably damaging	1.00
R2210:Lmtk2	UTSW	5	144,084,427 (GRCm39)	missense	probably damaging	1.00
R2289:Lmtk2	UTSW	5	144,112,924 (GRCm39)	missense	possibly damaging	0.80
R2312:Lmtk2	UTSW	5	144,110,444 (GRCm39)	missense	probably damaging	1.00
R2352:Lmtk2	UTSW	5	144,110,729 (GRCm39)	missense	probably benign	0.05
R3870:Lmtk2	UTSW	5	144,103,245 (GRCm39)	splice site	probably benign
R4011:Lmtk2	UTSW	5	144,112,697 (GRCm39)	missense	probably benign	0.01
R4272:Lmtk2	UTSW	5	144,120,044 (GRCm39)	missense	probably benign	0.05
R4361:Lmtk2	UTSW	5	144,084,482 (GRCm39)	missense	probably damaging	1.00
R4580:Lmtk2	UTSW	5	144,111,599 (GRCm39)	missense	possibly damaging	0.56
R4621:Lmtk2	UTSW	5	144,111,752 (GRCm39)	missense	probably benign	0.02
R4981:Lmtk2	UTSW	5	144,113,265 (GRCm39)	missense	probably damaging	1.00
R5818:Lmtk2	UTSW	5	144,093,718 (GRCm39)	missense	probably benign	0.07
R5984:Lmtk2	UTSW	5	144,111,656 (GRCm39)	missense	probably benign
R6083:Lmtk2	UTSW	5	144,119,574 (GRCm39)	missense	probably damaging	1.00
R6180:Lmtk2	UTSW	5	144,112,160 (GRCm39)	missense	probably damaging	1.00
R6411:Lmtk2	UTSW	5	144,111,404 (GRCm39)	missense	probably damaging	0.99
R6544:Lmtk2	UTSW	5	144,110,624 (GRCm39)	missense	possibly damaging	0.68
R6628:Lmtk2	UTSW	5	144,111,503 (GRCm39)	missense	probably benign	0.03
R6698:Lmtk2	UTSW	5	144,111,737 (GRCm39)	missense	probably benign	0.02
R6742:Lmtk2	UTSW	5	144,085,175 (GRCm39)	missense	probably damaging	1.00
R6763:Lmtk2	UTSW	5	144,110,615 (GRCm39)	missense	probably damaging	1.00
R7286:Lmtk2	UTSW	5	144,111,178 (GRCm39)	nonsense	probably null
R7390:Lmtk2	UTSW	5	144,066,261 (GRCm39)	missense	possibly damaging	0.79
R7594:Lmtk2	UTSW	5	144,110,564 (GRCm39)	missense	probably damaging	1.00
R7660:Lmtk2	UTSW	5	144,085,158 (GRCm39)	missense	probably damaging	1.00
R7785:Lmtk2	UTSW	5	144,111,571 (GRCm39)	missense	probably benign	0.00
R7977:Lmtk2	UTSW	5	144,111,959 (GRCm39)	missense	probably benign	0.02
R7987:Lmtk2	UTSW	5	144,111,959 (GRCm39)	missense	probably benign	0.02
R8089:Lmtk2	UTSW	5	144,093,718 (GRCm39)	missense	probably benign	0.07
R8138:Lmtk2	UTSW	5	144,112,415 (GRCm39)	missense	probably damaging	0.99
R8694:Lmtk2	UTSW	5	144,108,566 (GRCm39)	missense	probably damaging	1.00
R8714:Lmtk2	UTSW	5	144,112,876 (GRCm39)	missense	probably damaging	1.00
R8816:Lmtk2	UTSW	5	144,112,793 (GRCm39)	nonsense	probably null
R8845:Lmtk2	UTSW	5	144,110,704 (GRCm39)	missense	probably damaging	1.00
R8856:Lmtk2	UTSW	5	144,113,079 (GRCm39)	missense	probably damaging	1.00
R9306:Lmtk2	UTSW	5	144,119,599 (GRCm39)	missense	probably benign	0.17
R9494:Lmtk2	UTSW	5	144,037,338 (GRCm39)	start gained	probably benign
X0024:Lmtk2	UTSW	5	144,111,068 (GRCm39)	missense	probably benign	0.22
Z1088:Lmtk2	UTSW	5	144,119,669 (GRCm39)	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- GTAACCAGCACAGTCCAGAAGTCTC -3'
(R):5'- GTGGCAGCAGCAAGTCAAACAC -3'

Sequencing Primer
(F):5'- ACAGTCCAGAAGTCTCTCTGC -3'
(R):5'- gcaagtcaaacacaaccattac -3'

Posted On

2013-08-06