Incidental Mutation 'R8371:Pik3c2g'
ID646389
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8371 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139936056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 923 (V923M)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087657
AA Change: V555M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: V555M

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111868
AA Change: V923M
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: V923M

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218528
AA Change: V805M
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,054,647 Q1050K probably benign Het
B4galt5 A G 2: 167,309,225 M121T probably damaging Het
Birc3 A G 9: 7,849,426 L549P probably damaging Het
Cacna1b T C 2: 24,720,024 N368S possibly damaging Het
Cbr1 A G 16: 93,609,891 E165G probably damaging Het
Ccdc178 T C 18: 21,811,504 D866G possibly damaging Het
Cd40 G A 2: 165,066,538 G178E probably damaging Het
Cers1 T A 8: 70,329,573 L349H probably benign Het
Chd8 T C 14: 52,232,818 K445R probably benign Het
Clca3a2 G T 3: 144,807,353 S477* probably null Het
Clec4a1 T A 6: 122,933,923 *246R probably null Het
CN725425 T C 15: 91,240,770 I171T probably benign Het
Crybg3 A G 16: 59,557,051 M1280T probably benign Het
Csf1r A T 18: 61,117,591 Q458L probably benign Het
Cyp3a11 A T 5: 145,868,628 V193E possibly damaging Het
Cys1 A G 12: 24,668,695 I53T probably benign Het
Dhrs3 A C 4: 144,919,383 probably null Het
Dhx57 T C 17: 80,275,490 R229G probably benign Het
Dhx9 T C 1: 153,456,215 N1336D unknown Het
Dmgdh T A 13: 93,708,730 H410Q probably benign Het
Dmxl1 T A 18: 49,898,714 M2225K probably benign Het
Eif4g3 T G 4: 138,096,845 Y80D probably damaging Het
Ephx4 A T 5: 107,413,518 I164F possibly damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fhl4 G A 10: 85,098,773 A48V probably benign Het
Fmn2 T C 1: 174,609,607 L1048S unknown Het
Gemin5 T C 11: 58,126,558 M1212V probably benign Het
Gm9195 C T 14: 72,460,459 V1294I probably benign Het
Gpr55 A T 1: 85,941,127 V244E probably damaging Het
Hgfac T A 5: 35,045,443 F429Y probably damaging Het
Jade2 T A 11: 51,825,132 E415D probably benign Het
Kcnj4 T A 15: 79,485,141 I213F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Krt82 T C 15: 101,545,111 E280G probably benign Het
Lemd1 C A 1: 132,228,949 Q40K probably damaging Het
Lmo7 T C 14: 101,887,008 L423P possibly damaging Het
Lrp8 A G 4: 107,869,071 Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mroh8 A T 2: 157,252,976 Y363* probably null Het
Olfr135 G A 17: 38,208,298 A18T probably benign Het
Olfr485 G A 7: 108,159,228 T215I probably benign Het
Olfr559 C A 7: 102,723,583 K302N probably damaging Het
Pcdha2 T C 18: 36,940,263 Y316H possibly damaging Het
Pcdha6 T A 18: 36,969,867 C704* probably null Het
Rhd A G 4: 134,876,383 S72G probably benign Het
Rhot1 T C 11: 80,243,466 L295P probably damaging Het
Rrp1b A G 17: 32,049,484 E139G possibly damaging Het
Scnn1a T G 6: 125,343,843 Y620D possibly damaging Het
Serpinb12 A T 1: 106,956,405 I294L probably benign Het
Serpinb3d T C 1: 107,080,739 D132G probably damaging Het
Slc26a3 A T 12: 31,452,542 D254V probably damaging Het
Srrm1 A T 4: 135,325,221 I614N unknown Het
Stt3b A G 9: 115,266,175 Y263H probably damaging Het
Taf7 T A 18: 37,643,499 K5I probably damaging Het
Tbck C A 3: 132,752,524 H638Q possibly damaging Het
Tnfsf9 A C 17: 57,105,541 D37A probably benign Het
Trim71 C A 9: 114,515,789 V354F probably benign Het
Tspoap1 T G 11: 87,778,301 C1467G probably benign Het
Xirp1 C T 9: 120,019,433 R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zfhx2 T C 14: 55,064,092 D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 T220A probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCCAGTTTAATCTTTGCCAG -3'
(R):5'- GTGTTGATTTGGCAACTTCCCC -3'

Sequencing Primer
(F):5'- CCAGAGTCATGGAGTCTATGC -3'
(R):5'- GATTTGGCAACTTCCCCGTGAG -3'
Posted On2020-09-02