Incidental Mutation 'R0039:Map3k10'
ID64639
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0039 (G1)
Quality Score158
Status Not validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27658098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 752 (S752P)
Ref Sequence ENSEMBL: ENSMUSP00000037725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008088] [ENSMUST00000036453] [ENSMUST00000108341]
Predicted Effect probably benign
Transcript: ENSMUST00000008088
SMART Domains Protein: ENSMUSP00000008088
Gene: ENSMUSG00000007944

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
low complexity region 49 65 N/A INTRINSIC
Blast:TPR 66 95 2e-7 BLAST
low complexity region 101 117 N/A INTRINSIC
Blast:TPR 133 168 1e-10 BLAST
Pfam:TPR_2 169 202 3.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036453
AA Change: S752P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: S752P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108341
AA Change: S752P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: S752P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0724:Map3k10 UTSW 7 27668355 missense probably damaging 1.00
R0729:Map3k10 UTSW 7 27661567 missense probably damaging 1.00
R1734:Map3k10 UTSW 7 27658115 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 unclassified probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R2517:Map3k10 UTSW 7 27663263 missense possibly damaging 0.92
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATTGCTTGGACAGGCCCCAC -3'
(R):5'- TCCCATTGCAGAAGAATTTGCGGAG -3'

Sequencing Primer
(F):5'- AGGCTCCCGTTGTCTCAAAG -3'
(R):5'- TAAGCTGTGCCACGCTG -3'
Posted On2013-08-06