Incidental Mutation 'R8371:Stt3b'
ID 646395
Institutional Source Beutler Lab
Gene Symbol Stt3b
Ensembl Gene ENSMUSG00000032437
Gene Name STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms 1300006C19Rik, Simp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock # R8371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 115242581-115310421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115266175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 263 (Y263H)
Ref Sequence ENSEMBL: ENSMUSP00000035010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035010]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035010
AA Change: Y263H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437
AA Change: Y263H

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of a protein complex that transfers oligosaccharides onto asparagine residues. Defects in this gene are a cause of congenital disorder of glycosylation Ix (CDG1X). [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,054,647 Q1050K probably benign Het
B4galt5 A G 2: 167,309,225 M121T probably damaging Het
Birc3 A G 9: 7,849,426 L549P probably damaging Het
Cacna1b T C 2: 24,720,024 N368S possibly damaging Het
Cbr1 A G 16: 93,609,891 E165G probably damaging Het
Ccdc178 T C 18: 21,811,504 D866G possibly damaging Het
Cd40 G A 2: 165,066,538 G178E probably damaging Het
Cers1 T A 8: 70,329,573 L349H probably benign Het
Chd8 T C 14: 52,232,818 K445R probably benign Het
Clca3a2 G T 3: 144,807,353 S477* probably null Het
Clec4a1 T A 6: 122,933,923 *246R probably null Het
CN725425 T C 15: 91,240,770 I171T probably benign Het
Crybg3 A G 16: 59,557,051 M1280T probably benign Het
Csf1r A T 18: 61,117,591 Q458L probably benign Het
Cyp3a11 A T 5: 145,868,628 V193E possibly damaging Het
Cys1 A G 12: 24,668,695 I53T probably benign Het
Dhrs3 A C 4: 144,919,383 probably null Het
Dhx57 T C 17: 80,275,490 R229G probably benign Het
Dhx9 T C 1: 153,456,215 N1336D unknown Het
Dmgdh T A 13: 93,708,730 H410Q probably benign Het
Dmxl1 T A 18: 49,898,714 M2225K probably benign Het
Eif4g3 T G 4: 138,096,845 Y80D probably damaging Het
Ephx4 A T 5: 107,413,518 I164F possibly damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fhl4 G A 10: 85,098,773 A48V probably benign Het
Fmn2 T C 1: 174,609,607 L1048S unknown Het
Gemin5 T C 11: 58,126,558 M1212V probably benign Het
Gm9195 C T 14: 72,460,459 V1294I probably benign Het
Gpr55 A T 1: 85,941,127 V244E probably damaging Het
Hgfac T A 5: 35,045,443 F429Y probably damaging Het
Jade2 T A 11: 51,825,132 E415D probably benign Het
Kcnj4 T A 15: 79,485,141 I213F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Krt82 T C 15: 101,545,111 E280G probably benign Het
Lemd1 C A 1: 132,228,949 Q40K probably damaging Het
Lmo7 T C 14: 101,887,008 L423P possibly damaging Het
Lrp8 A G 4: 107,869,071 Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mroh8 A T 2: 157,252,976 Y363* probably null Het
Olfr135 G A 17: 38,208,298 A18T probably benign Het
Olfr485 G A 7: 108,159,228 T215I probably benign Het
Olfr559 C A 7: 102,723,583 K302N probably damaging Het
Pcdha2 T C 18: 36,940,263 Y316H possibly damaging Het
Pcdha6 T A 18: 36,969,867 C704* probably null Het
Pik3c2g G A 6: 139,936,056 V923M unknown Het
Rhd A G 4: 134,876,383 S72G probably benign Het
Rhot1 T C 11: 80,243,466 L295P probably damaging Het
Rrp1b A G 17: 32,049,484 E139G possibly damaging Het
Scnn1a T G 6: 125,343,843 Y620D possibly damaging Het
Serpinb12 A T 1: 106,956,405 I294L probably benign Het
Serpinb3d T C 1: 107,080,739 D132G probably damaging Het
Slc26a3 A T 12: 31,452,542 D254V probably damaging Het
Srrm1 A T 4: 135,325,221 I614N unknown Het
Taf7 T A 18: 37,643,499 K5I probably damaging Het
Tbck C A 3: 132,752,524 H638Q possibly damaging Het
Tnfsf9 A C 17: 57,105,541 D37A probably benign Het
Trim71 C A 9: 114,515,789 V354F probably benign Het
Tspoap1 T G 11: 87,778,301 C1467G probably benign Het
Xirp1 C T 9: 120,019,433 R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zfhx2 T C 14: 55,064,092 D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 T220A probably benign Het
Other mutations in Stt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Stt3b APN 9 115251847 missense probably benign 0.42
IGL00929:Stt3b APN 9 115266165 missense probably damaging 1.00
IGL01333:Stt3b APN 9 115257544 missense probably damaging 0.97
IGL01389:Stt3b APN 9 115253900 missense probably benign
IGL01680:Stt3b APN 9 115246261 splice site probably benign
IGL01980:Stt3b APN 9 115276699 splice site probably null
IGL02351:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02358:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02421:Stt3b APN 9 115251852 splice site probably benign
IGL02602:Stt3b APN 9 115276778 missense probably damaging 1.00
IGL03231:Stt3b APN 9 115243994 missense unknown
supersonic UTSW 9 115254017 missense probably damaging 1.00
R0482:Stt3b UTSW 9 115248567 missense probably benign 0.10
R1221:Stt3b UTSW 9 115257499 missense probably benign 0.00
R1437:Stt3b UTSW 9 115254927 missense probably damaging 1.00
R1477:Stt3b UTSW 9 115266192 missense probably damaging 1.00
R1604:Stt3b UTSW 9 115250927 missense probably damaging 1.00
R1796:Stt3b UTSW 9 115248607 nonsense probably null
R4112:Stt3b UTSW 9 115266138 missense probably damaging 1.00
R4166:Stt3b UTSW 9 115254901 missense probably damaging 1.00
R4695:Stt3b UTSW 9 115254794 missense probably damaging 1.00
R5183:Stt3b UTSW 9 115266143 missense probably damaging 0.99
R5317:Stt3b UTSW 9 115252510 nonsense probably null
R5631:Stt3b UTSW 9 115254845 missense probably benign 0.05
R5665:Stt3b UTSW 9 115266147 missense probably damaging 1.00
R6495:Stt3b UTSW 9 115267320 missense possibly damaging 0.46
R6517:Stt3b UTSW 9 115267342 missense probably benign
R6525:Stt3b UTSW 9 115258558 missense probably damaging 1.00
R6593:Stt3b UTSW 9 115252511 missense probably damaging 0.99
R7065:Stt3b UTSW 9 115266156 missense probably damaging 1.00
R7071:Stt3b UTSW 9 115254017 missense probably damaging 1.00
R7297:Stt3b UTSW 9 115276957 missense probably damaging 1.00
R7313:Stt3b UTSW 9 115266115 missense probably damaging 0.99
R7554:Stt3b UTSW 9 115280409 critical splice donor site probably null
R7790:Stt3b UTSW 9 115276819 missense probably damaging 1.00
R7802:Stt3b UTSW 9 115276881 missense probably damaging 1.00
R8305:Stt3b UTSW 9 115254931 missense probably damaging 1.00
R8361:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8362:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8363:Stt3b UTSW 9 115254920 missense probably damaging 1.00
R8799:Stt3b UTSW 9 115248617 missense probably damaging 1.00
R8996:Stt3b UTSW 9 115243997 missense unknown
R9215:Stt3b UTSW 9 115256155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGTAATCAACACAAGGCAAG -3'
(R):5'- CTAACTTGAGCTATTCTCCATTGAG -3'

Sequencing Primer
(F):5'- TGTAATCAACACAAGGCAAGTTAAAC -3'
(R):5'- CTTGAGCTATTCTCCATTGAGTTTAG -3'
Posted On 2020-09-02