Incidental Mutation 'R8371:Xirp1'
ID646396
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Namexin actin-binding repeat containing 1
SynonymsCmya1, Xin, mXin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R8371 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120013755-120023598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120019433 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 128 (R128Q)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111635
AA Change: R128Q

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: R128Q

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,054,647 Q1050K probably benign Het
B4galt5 A G 2: 167,309,225 M121T probably damaging Het
Birc3 A G 9: 7,849,426 L549P probably damaging Het
Cacna1b T C 2: 24,720,024 N368S possibly damaging Het
Cbr1 A G 16: 93,609,891 E165G probably damaging Het
Ccdc178 T C 18: 21,811,504 D866G possibly damaging Het
Cd40 G A 2: 165,066,538 G178E probably damaging Het
Cers1 T A 8: 70,329,573 L349H probably benign Het
Chd8 T C 14: 52,232,818 K445R probably benign Het
Clca3a2 G T 3: 144,807,353 S477* probably null Het
Clec4a1 T A 6: 122,933,923 *246R probably null Het
CN725425 T C 15: 91,240,770 I171T probably benign Het
Crybg3 A G 16: 59,557,051 M1280T probably benign Het
Csf1r A T 18: 61,117,591 Q458L probably benign Het
Cyp3a11 A T 5: 145,868,628 V193E possibly damaging Het
Cys1 A G 12: 24,668,695 I53T probably benign Het
Dhrs3 A C 4: 144,919,383 probably null Het
Dhx57 T C 17: 80,275,490 R229G probably benign Het
Dhx9 T C 1: 153,456,215 N1336D unknown Het
Dmgdh T A 13: 93,708,730 H410Q probably benign Het
Dmxl1 T A 18: 49,898,714 M2225K probably benign Het
Eif4g3 T G 4: 138,096,845 Y80D probably damaging Het
Ephx4 A T 5: 107,413,518 I164F possibly damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fhl4 G A 10: 85,098,773 A48V probably benign Het
Fmn2 T C 1: 174,609,607 L1048S unknown Het
Gemin5 T C 11: 58,126,558 M1212V probably benign Het
Gm9195 C T 14: 72,460,459 V1294I probably benign Het
Gpr55 A T 1: 85,941,127 V244E probably damaging Het
Hgfac T A 5: 35,045,443 F429Y probably damaging Het
Jade2 T A 11: 51,825,132 E415D probably benign Het
Kcnj4 T A 15: 79,485,141 I213F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Krt82 T C 15: 101,545,111 E280G probably benign Het
Lemd1 C A 1: 132,228,949 Q40K probably damaging Het
Lmo7 T C 14: 101,887,008 L423P possibly damaging Het
Lrp8 A G 4: 107,869,071 Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mroh8 A T 2: 157,252,976 Y363* probably null Het
Olfr135 G A 17: 38,208,298 A18T probably benign Het
Olfr485 G A 7: 108,159,228 T215I probably benign Het
Olfr559 C A 7: 102,723,583 K302N probably damaging Het
Pcdha2 T C 18: 36,940,263 Y316H possibly damaging Het
Pcdha6 T A 18: 36,969,867 C704* probably null Het
Pik3c2g G A 6: 139,936,056 V923M unknown Het
Rhd A G 4: 134,876,383 S72G probably benign Het
Rhot1 T C 11: 80,243,466 L295P probably damaging Het
Rrp1b A G 17: 32,049,484 E139G possibly damaging Het
Scnn1a T G 6: 125,343,843 Y620D possibly damaging Het
Serpinb12 A T 1: 106,956,405 I294L probably benign Het
Serpinb3d T C 1: 107,080,739 D132G probably damaging Het
Slc26a3 A T 12: 31,452,542 D254V probably damaging Het
Srrm1 A T 4: 135,325,221 I614N unknown Het
Stt3b A G 9: 115,266,175 Y263H probably damaging Het
Taf7 T A 18: 37,643,499 K5I probably damaging Het
Tbck C A 3: 132,752,524 H638Q possibly damaging Het
Tnfsf9 A C 17: 57,105,541 D37A probably benign Het
Trim71 C A 9: 114,515,789 V354F probably benign Het
Tspoap1 T G 11: 87,778,301 C1467G probably benign Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zfhx2 T C 14: 55,064,092 D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 T220A probably benign Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 120017919 missense probably damaging 1.00
IGL02105:Xirp1 APN 9 120016997 missense probably damaging 1.00
IGL03365:Xirp1 APN 9 120018539 missense probably damaging 0.99
busybody UTSW 9 120019753 missense possibly damaging 0.92
Buzzer UTSW 9 120018491 missense probably damaging 1.00
cornflower UTSW 9 120019815 start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 120017454 missense probably benign 0.01
R0320:Xirp1 UTSW 9 120016467 missense probably benign 0.00
R0881:Xirp1 UTSW 9 120018417 missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 120017916 missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 120018775 missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120016907 missense probably benign
R1785:Xirp1 UTSW 9 120016907 missense probably benign
R1978:Xirp1 UTSW 9 120018591 missense probably benign 0.00
R1983:Xirp1 UTSW 9 120016629 nonsense probably null
R2064:Xirp1 UTSW 9 120016896 missense probably benign 0.00
R2860:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2860:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2919:Xirp1 UTSW 9 120018701 missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 120019785 missense probably benign
R3704:Xirp1 UTSW 9 120016907 missense probably benign 0.04
R3898:Xirp1 UTSW 9 120019340 missense probably benign 0.00
R3981:Xirp1 UTSW 9 120017744 missense probably damaging 0.98
R4609:Xirp1 UTSW 9 120016506 missense probably benign
R4613:Xirp1 UTSW 9 120019682 missense probably damaging 1.00
R4660:Xirp1 UTSW 9 120016992 missense probably damaging 1.00
R4703:Xirp1 UTSW 9 120017027 missense probably damaging 1.00
R4825:Xirp1 UTSW 9 120017003 missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 120018792 missense probably damaging 1.00
R5297:Xirp1 UTSW 9 120019602 missense probably damaging 1.00
R5939:Xirp1 UTSW 9 120018509 missense probably benign 0.01
R6091:Xirp1 UTSW 9 120017963 missense probably benign 0.01
R6290:Xirp1 UTSW 9 120018725 missense probably benign
R6376:Xirp1 UTSW 9 120018491 missense probably damaging 1.00
R6515:Xirp1 UTSW 9 120016917 missense probably benign 0.00
R6616:Xirp1 UTSW 9 120019014 missense probably damaging 0.98
R6976:Xirp1 UTSW 9 120017918 missense probably damaging 1.00
R7165:Xirp1 UTSW 9 120019047 missense probably damaging 1.00
R7471:Xirp1 UTSW 9 120019110 nonsense probably null
R7744:Xirp1 UTSW 9 120016846 missense possibly damaging 0.77
R7847:Xirp1 UTSW 9 120019753 missense possibly damaging 0.92
R8010:Xirp1 UTSW 9 120017824 missense probably benign 0.00
V8831:Xirp1 UTSW 9 120016907 missense probably benign
X0025:Xirp1 UTSW 9 120019155 missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120016907 missense probably benign
Z1176:Xirp1 UTSW 9 120016880 missense probably damaging 0.96
Z1176:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120017154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCTGTACATCTCCAGTGG -3'
(R):5'- TCCGGCGTCTCTACAAACAC -3'

Sequencing Primer
(F):5'- TGTACATCTCCAGTGGCTGCAG -3'
(R):5'- ATCCACCCTGAGCTTCGGAAG -3'
Posted On2020-09-02