Incidental Mutation 'R0039:Esyt1'
ID64642
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Nameextended synaptotagmin-like protein 1
Synonymsvp115, Mbc2, Fam62a
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0039 (G1)
Quality Score88
Status Not validated
Chromosome10
Chromosomal Location128509965-128525871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128520962 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 300 (V300A)
Ref Sequence ENSEMBL: ENSMUSP00000026427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
Predicted Effect probably damaging
Transcript: ENSMUST00000026427
AA Change: V300A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366
AA Change: V300A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220045
Predicted Effect probably benign
Transcript: ENSMUST00000220429
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128517635 missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128521874 missense probably benign 0.00
IGL00534:Esyt1 APN 10 128515684 critical splice donor site probably null
IGL00578:Esyt1 APN 10 128511743 missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128517063 missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128519791 missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128518941 missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128511494 missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128522312 missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128512367 missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128512424 missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128522093 missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128511008 missense probably benign
IGL02948:Esyt1 APN 10 128519171 missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128516757 missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128516383 missense probably benign 0.00
R0285:Esyt1 UTSW 10 128512218 missense possibly damaging 0.50
R0453:Esyt1 UTSW 10 128512209 missense probably benign 0.00
R1123:Esyt1 UTSW 10 128516558 missense probably benign 0.35
R1496:Esyt1 UTSW 10 128512428 missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128518994 missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128525534 missense probably benign 0.01
R1813:Esyt1 UTSW 10 128519618 missense probably benign
R1827:Esyt1 UTSW 10 128516369 missense probably benign 0.01
R2038:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2039:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2115:Esyt1 UTSW 10 128522104 missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128517045 missense probably damaging 1.00
R3919:Esyt1 UTSW 10 128521036 unclassified probably benign
R3980:Esyt1 UTSW 10 128511524 missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128516574 missense probably benign 0.00
R5534:Esyt1 UTSW 10 128519460 missense probably benign 0.07
R5704:Esyt1 UTSW 10 128511510 missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128511902 missense probably benign 0.01
R6431:Esyt1 UTSW 10 128516674 critical splice donor site probably null
R7013:Esyt1 UTSW 10 128525651 missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128516236 missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128515760 missense possibly damaging 0.79
R7570:Esyt1 UTSW 10 128518932 missense possibly damaging 0.52
R7700:Esyt1 UTSW 10 128515854 splice site probably benign
R7732:Esyt1 UTSW 10 128521825 critical splice donor site probably null
R8009:Esyt1 UTSW 10 128511485 missense probably benign 0.01
R8049:Esyt1 UTSW 10 128512086 missense probably benign
R8222:Esyt1 UTSW 10 128511778 missense possibly damaging 0.77
R8365:Esyt1 UTSW 10 128516553 missense possibly damaging 0.89
R8366:Esyt1 UTSW 10 128516553 missense possibly damaging 0.89
R8407:Esyt1 UTSW 10 128511927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTCCTTGGAACTCAGACCTCG -3'
(R):5'- TCTGGACTTCCCAAAGTGCCAAC -3'

Sequencing Primer
(F):5'- AACTCAGACCTCGGGCTG -3'
(R):5'- gtgggaggttggagtttagtg -3'
Posted On2013-08-06