Mutagenetix > Incidental Mutation

Incidental Mutation 'R8371:Dhx57'

646421

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R8371 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80275490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 229 (R229G)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably benign
Transcript: ENSMUST00000038166
AA Change: R176G

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: R176G

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086555
AA Change: R229G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: R229G

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	G	T	11: 110,054,647	Q1050K	probably benign	Het
B4galt5	A	G	2: 167,309,225	M121T	probably damaging	Het
Birc3	A	G	9: 7,849,426	L549P	probably damaging	Het
Cacna1b	T	C	2: 24,720,024	N368S	possibly damaging	Het
Cbr1	A	G	16: 93,609,891	E165G	probably damaging	Het
Ccdc178	T	C	18: 21,811,504	D866G	possibly damaging	Het
Cd40	G	A	2: 165,066,538	G178E	probably damaging	Het
Cers1	T	A	8: 70,329,573	L349H	probably benign	Het
Chd8	T	C	14: 52,232,818	K445R	probably benign	Het
Clca3a2	G	T	3: 144,807,353	S477*	probably null	Het
Clec4a1	T	A	6: 122,933,923	*246R	probably null	Het
CN725425	T	C	15: 91,240,770	I171T	probably benign	Het
Crybg3	A	G	16: 59,557,051	M1280T	probably benign	Het
Csf1r	A	T	18: 61,117,591	Q458L	probably benign	Het
Cyp3a11	A	T	5: 145,868,628	V193E	possibly damaging	Het
Cys1	A	G	12: 24,668,695	I53T	probably benign	Het
Dhrs3	A	C	4: 144,919,383		probably null	Het
Dhx9	T	C	1: 153,456,215	N1336D	unknown	Het
Dmgdh	T	A	13: 93,708,730	H410Q	probably benign	Het
Dmxl1	T	A	18: 49,898,714	M2225K	probably benign	Het
Eif4g3	T	G	4: 138,096,845	Y80D	probably damaging	Het
Ephx4	A	T	5: 107,413,518	I164F	possibly damaging	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Fhl4	G	A	10: 85,098,773	A48V	probably benign	Het
Fmn2	T	C	1: 174,609,607	L1048S	unknown	Het
Gemin5	T	C	11: 58,126,558	M1212V	probably benign	Het
Gm9195	C	T	14: 72,460,459	V1294I	probably benign	Het
Gpr55	A	T	1: 85,941,127	V244E	probably damaging	Het
Hgfac	T	A	5: 35,045,443	F429Y	probably damaging	Het
Jade2	T	A	11: 51,825,132	E415D	probably benign	Het
Kcnj4	T	A	15: 79,485,141	I213F	probably damaging	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Klhl33	C	T	14: 50,892,232	R312Q	probably damaging	Het
Krt82	T	C	15: 101,545,111	E280G	probably benign	Het
Lemd1	C	A	1: 132,228,949	Q40K	probably damaging	Het
Lmo7	T	C	14: 101,887,008	L423P	possibly damaging	Het
Lrp8	A	G	4: 107,869,071	Y773C	probably damaging	Het
Miga2	AAGAG	AAG	2: 30,375,743		probably null	Het
Mroh8	A	T	2: 157,252,976	Y363*	probably null	Het
Olfr135	G	A	17: 38,208,298	A18T	probably benign	Het
Olfr485	G	A	7: 108,159,228	T215I	probably benign	Het
Olfr559	C	A	7: 102,723,583	K302N	probably damaging	Het
Pcdha2	T	C	18: 36,940,263	Y316H	possibly damaging	Het
Pcdha6	T	A	18: 36,969,867	C704*	probably null	Het
Pik3c2g	G	A	6: 139,936,056	V923M	unknown	Het
Rhd	A	G	4: 134,876,383	S72G	probably benign	Het
Rhot1	T	C	11: 80,243,466	L295P	probably damaging	Het
Rrp1b	A	G	17: 32,049,484	E139G	possibly damaging	Het
Scnn1a	T	G	6: 125,343,843	Y620D	possibly damaging	Het
Serpinb12	A	T	1: 106,956,405	I294L	probably benign	Het
Serpinb3d	T	C	1: 107,080,739	D132G	probably damaging	Het
Slc26a3	A	T	12: 31,452,542	D254V	probably damaging	Het
Srrm1	A	T	4: 135,325,221	I614N	unknown	Het
Stt3b	A	G	9: 115,266,175	Y263H	probably damaging	Het
Taf7	T	A	18: 37,643,499	K5I	probably damaging	Het
Tbck	C	A	3: 132,752,524	H638Q	possibly damaging	Het
Tnfsf9	A	C	17: 57,105,541	D37A	probably benign	Het
Trim71	C	A	9: 114,515,789	V354F	probably benign	Het
Tspoap1	T	G	11: 87,778,301	C1467G	probably benign	Het
Xirp1	C	T	9: 120,019,433	R128Q	possibly damaging	Het
Zc3h12d	GCCC	GCC	10: 7,839,971		probably null	Het
Zfhx2	T	C	14: 55,064,092	D2145G	probably damaging	Het
Zfy2	T	C	Y: 2,117,168	T220A	probably benign	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGTTTCAGGCGAAGTGTCC -3'
(R):5'- GTCCACAGTTGTAACTCCATATTTG -3'

Sequencing Primer
(F):5'- TTTCAGGCGAAGTGTCCCGTAC -3'
(R):5'- CTCTCACGTCAGTGATGT -3'

Posted On

2020-09-02