Incidental Mutation 'R8371:Dhx57'
ID 646421
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 067740-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R8371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80582919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 229 (R229G)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: R176G

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: R176G

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086555
AA Change: R229G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: R229G

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 109,945,473 (GRCm39) Q1050K probably benign Het
B4galt5 A G 2: 167,151,145 (GRCm39) M121T probably damaging Het
Birc2 A G 9: 7,849,427 (GRCm39) L549P probably damaging Het
Cacna1b T C 2: 24,610,036 (GRCm39) N368S possibly damaging Het
Cbr1 A G 16: 93,406,779 (GRCm39) E165G probably damaging Het
Ccdc178 T C 18: 21,944,561 (GRCm39) D866G possibly damaging Het
Cd40 G A 2: 164,908,458 (GRCm39) G178E probably damaging Het
Cers1 T A 8: 70,782,223 (GRCm39) L349H probably benign Het
Chd8 T C 14: 52,470,275 (GRCm39) K445R probably benign Het
Clca3a2 G T 3: 144,513,114 (GRCm39) S477* probably null Het
Clec4a1 T A 6: 122,910,882 (GRCm39) *246R probably null Het
CN725425 T C 15: 91,124,973 (GRCm39) I171T probably benign Het
Crybg3 A G 16: 59,377,414 (GRCm39) M1280T probably benign Het
Csf1r A T 18: 61,250,663 (GRCm39) Q458L probably benign Het
Cyp3a11 A T 5: 145,805,438 (GRCm39) V193E possibly damaging Het
Cys1 A G 12: 24,718,694 (GRCm39) I53T probably benign Het
Dhrs3 A C 4: 144,645,953 (GRCm39) probably null Het
Dhx9 T C 1: 153,331,961 (GRCm39) N1336D unknown Het
Dmgdh T A 13: 93,845,238 (GRCm39) H410Q probably benign Het
Dmxl1 T A 18: 50,031,781 (GRCm39) M2225K probably benign Het
Eif4g3 T G 4: 137,824,156 (GRCm39) Y80D probably damaging Het
Ephx4 A T 5: 107,561,384 (GRCm39) I164F possibly damaging Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Fhl4 G A 10: 84,934,637 (GRCm39) A48V probably benign Het
Fmn2 T C 1: 174,437,173 (GRCm39) L1048S unknown Het
Gemin5 T C 11: 58,017,384 (GRCm39) M1212V probably benign Het
Gm9195 C T 14: 72,697,899 (GRCm39) V1294I probably benign Het
Gpr55 A T 1: 85,868,849 (GRCm39) V244E probably damaging Het
Hgfac T A 5: 35,202,787 (GRCm39) F429Y probably damaging Het
Jade2 T A 11: 51,715,959 (GRCm39) E415D probably benign Het
Kcnj4 T A 15: 79,369,342 (GRCm39) I213F probably damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Klhl33 C T 14: 51,129,689 (GRCm39) R312Q probably damaging Het
Krt82 T C 15: 101,453,546 (GRCm39) E280G probably benign Het
Lemd1 C A 1: 132,156,687 (GRCm39) Q40K probably damaging Het
Lmo7 T C 14: 102,124,444 (GRCm39) L423P possibly damaging Het
Lrp8 A G 4: 107,726,268 (GRCm39) Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mroh8 A T 2: 157,094,896 (GRCm39) Y363* probably null Het
Or2n1c G A 17: 38,519,189 (GRCm39) A18T probably benign Het
Or51a25 C A 7: 102,372,790 (GRCm39) K302N probably damaging Het
Or5p61 G A 7: 107,758,435 (GRCm39) T215I probably benign Het
Pcdha2 T C 18: 37,073,316 (GRCm39) Y316H possibly damaging Het
Pcdha6 T A 18: 37,102,920 (GRCm39) C704* probably null Het
Pik3c2g G A 6: 139,881,782 (GRCm39) V923M unknown Het
Rhd A G 4: 134,603,694 (GRCm39) S72G probably benign Het
Rhot1 T C 11: 80,134,292 (GRCm39) L295P probably damaging Het
Rrp1b A G 17: 32,268,458 (GRCm39) E139G possibly damaging Het
Scnn1a T G 6: 125,320,806 (GRCm39) Y620D possibly damaging Het
Serpinb12 A T 1: 106,884,135 (GRCm39) I294L probably benign Het
Serpinb3d T C 1: 107,008,469 (GRCm39) D132G probably damaging Het
Slc26a3 A T 12: 31,502,541 (GRCm39) D254V probably damaging Het
Srrm1 A T 4: 135,052,532 (GRCm39) I614N unknown Het
Stt3b A G 9: 115,095,243 (GRCm39) Y263H probably damaging Het
Taf7 T A 18: 37,776,552 (GRCm39) K5I probably damaging Het
Tbck C A 3: 132,458,285 (GRCm39) H638Q possibly damaging Het
Tnfsf9 A C 17: 57,412,541 (GRCm39) D37A probably benign Het
Trim71 C A 9: 114,344,857 (GRCm39) V354F probably benign Het
Tspoap1 T G 11: 87,669,127 (GRCm39) C1467G probably benign Het
Xirp1 C T 9: 119,848,499 (GRCm39) R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,715,735 (GRCm39) probably null Het
Zfhx2 T C 14: 55,301,549 (GRCm39) D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 (GRCm39) T220A probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTTTCAGGCGAAGTGTCC -3'
(R):5'- GTCCACAGTTGTAACTCCATATTTG -3'

Sequencing Primer
(F):5'- TTTCAGGCGAAGTGTCCCGTAC -3'
(R):5'- CTCTCACGTCAGTGATGT -3'
Posted On 2020-09-02