Incidental Mutation 'R8371:Dmxl1'
ID646426
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R8371 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49898714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2225 (M2225K)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: M2225K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: M2225K

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: M2225K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: M2225K

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 110,054,647 Q1050K probably benign Het
B4galt5 A G 2: 167,309,225 M121T probably damaging Het
Birc3 A G 9: 7,849,426 L549P probably damaging Het
Cacna1b T C 2: 24,720,024 N368S possibly damaging Het
Cbr1 A G 16: 93,609,891 E165G probably damaging Het
Ccdc178 T C 18: 21,811,504 D866G possibly damaging Het
Cd40 G A 2: 165,066,538 G178E probably damaging Het
Cers1 T A 8: 70,329,573 L349H probably benign Het
Chd8 T C 14: 52,232,818 K445R probably benign Het
Clca3a2 G T 3: 144,807,353 S477* probably null Het
Clec4a1 T A 6: 122,933,923 *246R probably null Het
CN725425 T C 15: 91,240,770 I171T probably benign Het
Crybg3 A G 16: 59,557,051 M1280T probably benign Het
Csf1r A T 18: 61,117,591 Q458L probably benign Het
Cyp3a11 A T 5: 145,868,628 V193E possibly damaging Het
Cys1 A G 12: 24,668,695 I53T probably benign Het
Dhrs3 A C 4: 144,919,383 probably null Het
Dhx57 T C 17: 80,275,490 R229G probably benign Het
Dhx9 T C 1: 153,456,215 N1336D unknown Het
Dmgdh T A 13: 93,708,730 H410Q probably benign Het
Eif4g3 T G 4: 138,096,845 Y80D probably damaging Het
Ephx4 A T 5: 107,413,518 I164F possibly damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fhl4 G A 10: 85,098,773 A48V probably benign Het
Fmn2 T C 1: 174,609,607 L1048S unknown Het
Gemin5 T C 11: 58,126,558 M1212V probably benign Het
Gm9195 C T 14: 72,460,459 V1294I probably benign Het
Gpr55 A T 1: 85,941,127 V244E probably damaging Het
Hgfac T A 5: 35,045,443 F429Y probably damaging Het
Jade2 T A 11: 51,825,132 E415D probably benign Het
Kcnj4 T A 15: 79,485,141 I213F probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Krt82 T C 15: 101,545,111 E280G probably benign Het
Lemd1 C A 1: 132,228,949 Q40K probably damaging Het
Lmo7 T C 14: 101,887,008 L423P possibly damaging Het
Lrp8 A G 4: 107,869,071 Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mroh8 A T 2: 157,252,976 Y363* probably null Het
Olfr135 G A 17: 38,208,298 A18T probably benign Het
Olfr485 G A 7: 108,159,228 T215I probably benign Het
Olfr559 C A 7: 102,723,583 K302N probably damaging Het
Pcdha2 T C 18: 36,940,263 Y316H possibly damaging Het
Pcdha6 T A 18: 36,969,867 C704* probably null Het
Pik3c2g G A 6: 139,936,056 V923M unknown Het
Rhd A G 4: 134,876,383 S72G probably benign Het
Rhot1 T C 11: 80,243,466 L295P probably damaging Het
Rrp1b A G 17: 32,049,484 E139G possibly damaging Het
Scnn1a T G 6: 125,343,843 Y620D possibly damaging Het
Serpinb12 A T 1: 106,956,405 I294L probably benign Het
Serpinb3d T C 1: 107,080,739 D132G probably damaging Het
Slc26a3 A T 12: 31,452,542 D254V probably damaging Het
Srrm1 A T 4: 135,325,221 I614N unknown Het
Stt3b A G 9: 115,266,175 Y263H probably damaging Het
Taf7 T A 18: 37,643,499 K5I probably damaging Het
Tbck C A 3: 132,752,524 H638Q possibly damaging Het
Tnfsf9 A C 17: 57,105,541 D37A probably benign Het
Trim71 C A 9: 114,515,789 V354F probably benign Het
Tspoap1 T G 11: 87,778,301 C1467G probably benign Het
Xirp1 C T 9: 120,019,433 R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,839,971 probably null Het
Zfhx2 T C 14: 55,064,092 D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 T220A probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
carnivora UTSW 18 49864383 missense probably damaging 0.99
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
R8402:Dmxl1 UTSW 18 49878326 nonsense probably null
R8402:Dmxl1 UTSW 18 49878327 missense probably benign 0.09
R8402:Dmxl1 UTSW 18 49878342 missense probably benign
R8423:Dmxl1 UTSW 18 49865116 missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49893394 missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGAATACCTCTCTTTTGG -3'
(R):5'- GCGCTTTCTGCAGTTACTAAAAG -3'

Sequencing Primer
(F):5'- GAATACCTCTCTTTTGGTTTGGAAAG -3'
(R):5'- CTGCAGTTACTAAAAGCAGTGTTGTG -3'
Posted On2020-09-02