Incidental Mutation 'R8371:Dmxl1'
ID 646426
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 067740-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R8371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50031781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 2225 (M2225K)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: M2225K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: M2225K

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: M2225K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: M2225K

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G T 11: 109,945,473 (GRCm39) Q1050K probably benign Het
B4galt5 A G 2: 167,151,145 (GRCm39) M121T probably damaging Het
Birc2 A G 9: 7,849,427 (GRCm39) L549P probably damaging Het
Cacna1b T C 2: 24,610,036 (GRCm39) N368S possibly damaging Het
Cbr1 A G 16: 93,406,779 (GRCm39) E165G probably damaging Het
Ccdc178 T C 18: 21,944,561 (GRCm39) D866G possibly damaging Het
Cd40 G A 2: 164,908,458 (GRCm39) G178E probably damaging Het
Cers1 T A 8: 70,782,223 (GRCm39) L349H probably benign Het
Chd8 T C 14: 52,470,275 (GRCm39) K445R probably benign Het
Clca3a2 G T 3: 144,513,114 (GRCm39) S477* probably null Het
Clec4a1 T A 6: 122,910,882 (GRCm39) *246R probably null Het
CN725425 T C 15: 91,124,973 (GRCm39) I171T probably benign Het
Crybg3 A G 16: 59,377,414 (GRCm39) M1280T probably benign Het
Csf1r A T 18: 61,250,663 (GRCm39) Q458L probably benign Het
Cyp3a11 A T 5: 145,805,438 (GRCm39) V193E possibly damaging Het
Cys1 A G 12: 24,718,694 (GRCm39) I53T probably benign Het
Dhrs3 A C 4: 144,645,953 (GRCm39) probably null Het
Dhx57 T C 17: 80,582,919 (GRCm39) R229G probably benign Het
Dhx9 T C 1: 153,331,961 (GRCm39) N1336D unknown Het
Dmgdh T A 13: 93,845,238 (GRCm39) H410Q probably benign Het
Eif4g3 T G 4: 137,824,156 (GRCm39) Y80D probably damaging Het
Ephx4 A T 5: 107,561,384 (GRCm39) I164F possibly damaging Het
Eppk1 C T 15: 75,994,319 (GRCm39) R854Q probably benign Het
Fhl4 G A 10: 84,934,637 (GRCm39) A48V probably benign Het
Fmn2 T C 1: 174,437,173 (GRCm39) L1048S unknown Het
Gemin5 T C 11: 58,017,384 (GRCm39) M1212V probably benign Het
Gm9195 C T 14: 72,697,899 (GRCm39) V1294I probably benign Het
Gpr55 A T 1: 85,868,849 (GRCm39) V244E probably damaging Het
Hgfac T A 5: 35,202,787 (GRCm39) F429Y probably damaging Het
Jade2 T A 11: 51,715,959 (GRCm39) E415D probably benign Het
Kcnj4 T A 15: 79,369,342 (GRCm39) I213F probably damaging Het
Kcnq5 G A 1: 21,549,648 (GRCm39) R360C probably damaging Het
Klhl33 C T 14: 51,129,689 (GRCm39) R312Q probably damaging Het
Krt82 T C 15: 101,453,546 (GRCm39) E280G probably benign Het
Lemd1 C A 1: 132,156,687 (GRCm39) Q40K probably damaging Het
Lmo7 T C 14: 102,124,444 (GRCm39) L423P possibly damaging Het
Lrp8 A G 4: 107,726,268 (GRCm39) Y773C probably damaging Het
Miga2 AAGAG AAG 2: 30,265,755 (GRCm39) probably null Het
Mroh8 A T 2: 157,094,896 (GRCm39) Y363* probably null Het
Or2n1c G A 17: 38,519,189 (GRCm39) A18T probably benign Het
Or51a25 C A 7: 102,372,790 (GRCm39) K302N probably damaging Het
Or5p61 G A 7: 107,758,435 (GRCm39) T215I probably benign Het
Pcdha2 T C 18: 37,073,316 (GRCm39) Y316H possibly damaging Het
Pcdha6 T A 18: 37,102,920 (GRCm39) C704* probably null Het
Pik3c2g G A 6: 139,881,782 (GRCm39) V923M unknown Het
Rhd A G 4: 134,603,694 (GRCm39) S72G probably benign Het
Rhot1 T C 11: 80,134,292 (GRCm39) L295P probably damaging Het
Rrp1b A G 17: 32,268,458 (GRCm39) E139G possibly damaging Het
Scnn1a T G 6: 125,320,806 (GRCm39) Y620D possibly damaging Het
Serpinb12 A T 1: 106,884,135 (GRCm39) I294L probably benign Het
Serpinb3d T C 1: 107,008,469 (GRCm39) D132G probably damaging Het
Slc26a3 A T 12: 31,502,541 (GRCm39) D254V probably damaging Het
Srrm1 A T 4: 135,052,532 (GRCm39) I614N unknown Het
Stt3b A G 9: 115,095,243 (GRCm39) Y263H probably damaging Het
Taf7 T A 18: 37,776,552 (GRCm39) K5I probably damaging Het
Tbck C A 3: 132,458,285 (GRCm39) H638Q possibly damaging Het
Tnfsf9 A C 17: 57,412,541 (GRCm39) D37A probably benign Het
Trim71 C A 9: 114,344,857 (GRCm39) V354F probably benign Het
Tspoap1 T G 11: 87,669,127 (GRCm39) C1467G probably benign Het
Xirp1 C T 9: 119,848,499 (GRCm39) R128Q possibly damaging Het
Zc3h12d GCCC GCC 10: 7,715,735 (GRCm39) probably null Het
Zfhx2 T C 14: 55,301,549 (GRCm39) D2145G probably damaging Het
Zfy2 T C Y: 2,117,168 (GRCm39) T220A probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGGGAATACCTCTCTTTTGG -3'
(R):5'- GCGCTTTCTGCAGTTACTAAAAG -3'

Sequencing Primer
(F):5'- GAATACCTCTCTTTTGGTTTGGAAAG -3'
(R):5'- CTGCAGTTACTAAAAGCAGTGTTGTG -3'
Posted On 2020-09-02