Incidental Mutation 'R8302:Nabp1'
ID 646429
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Name nucleic acid binding protein 1
Synonyms 4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R8302 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 51465862-51478425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51472339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 140 (F140L)
Ref Sequence ENSEMBL: ENSMUSP00000027279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000190103]
AlphaFold Q8BGW5
Predicted Effect probably benign
Transcript: ENSMUST00000027279
AA Change: F140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107
AA Change: F140L

DomainStartEndE-ValueType
PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185534
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186003
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186684
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188051
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188204
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189542
AA Change: F60L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107
AA Change: F60L

DomainStartEndE-ValueType
PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190103
AA Change: F140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107
AA Change: F140L

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R0898:Nabp1 UTSW 1 51471337 missense probably benign
R1608:Nabp1 UTSW 1 51473003 splice site probably null
R1614:Nabp1 UTSW 1 51471352 missense possibly damaging 0.70
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R4632:Nabp1 UTSW 1 51474602 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8251:Nabp1 UTSW 1 51477578 missense probably benign 0.04
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTCAATATACCGGCATG -3'
(R):5'- CTGAAGCAAATATCAGGCAGTAC -3'

Sequencing Primer
(F):5'- GTGCTCAATATACCGGCATGTACAAG -3'
(R):5'- CAGGCAGTACTGAGTATAATAAACAC -3'
Posted On 2020-09-02