Incidental Mutation 'R0039:Specc1'
ID64643
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0039 (G1)
Quality Score141
Status Not validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62029369 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 32 (M32L)
Ref Sequence ENSEMBL: ENSMUSP00000144161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000108709] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000202178] [ENSMUST00000202389] [ENSMUST00000202905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049836
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108709
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136971
Predicted Effect possibly damaging
Transcript: ENSMUST00000201364
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201624
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201671
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201866
Predicted Effect probably damaging
Transcript: ENSMUST00000202178
AA Change: M32L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202389
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202869
Predicted Effect possibly damaging
Transcript: ENSMUST00000202905
AA Change: M32L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: M32L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 splice site probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7560:Specc1 UTSW 11 62128409 critical splice donor site probably null
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R8310:Specc1 UTSW 11 62132345 missense probably damaging 1.00
R8319:Specc1 UTSW 11 62118675 missense possibly damaging 0.77
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCCTAAACCCTACCACCATTCTGTG -3'
(R):5'- CTCTGTTGGATGCCAAGGGGATAAG -3'

Sequencing Primer
(F):5'- ACCATTCTGTGGTGGCATCTG -3'
(R):5'- TATGAGCCTGACTCCATCTAGGG -3'
Posted On2013-08-06