Incidental Mutation 'R8302:Frmd5'
ID646434
Institutional Source Beutler Lab
Gene Symbol Frmd5
Ensembl Gene ENSMUSG00000027238
Gene NameFERM domain containing 5
SynonymsA930004K21Rik, 1500032A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121545529-121807087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121547579 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 435 (T435S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028676] [ENSMUST00000110592] [ENSMUST00000110593] [ENSMUST00000110602] [ENSMUST00000110603] [ENSMUST00000121219] [ENSMUST00000128428] [ENSMUST00000138157] [ENSMUST00000155570] [ENSMUST00000212518]
Predicted Effect probably benign
Transcript: ENSMUST00000028676
SMART Domains Protein: ENSMUSP00000028676
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110592
SMART Domains Protein: ENSMUSP00000106222
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110593
SMART Domains Protein: ENSMUSP00000106223
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
low complexity region 489 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110602
SMART Domains Protein: ENSMUSP00000106232
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110603
SMART Domains Protein: ENSMUSP00000106234
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 56 94 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 138 147 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
WD40 303 342 8.59e-1 SMART
WD40 347 387 1.63e-4 SMART
WD40 390 429 1.98e1 SMART
WD40 434 473 4.75e1 SMART
WD40 481 521 9.24e-4 SMART
low complexity region 522 533 N/A INTRINSIC
WD40 577 618 2.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121219
SMART Domains Protein: ENSMUSP00000113568
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 1 121 1.92e-4 SMART
FERM_C 125 213 6.86e-24 SMART
FA 219 265 1.45e-13 SMART
low complexity region 363 385 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128428
SMART Domains Protein: ENSMUSP00000116468
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 202 3.21e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131092
SMART Domains Protein: ENSMUSP00000118272
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
FA 2 45 2.55e-9 SMART
low complexity region 143 165 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133898
AA Change: T435S
SMART Domains Protein: ENSMUSP00000118269
Gene: ENSMUSG00000027238
AA Change: T435S

DomainStartEndE-ValueType
B41 1 129 8.68e-9 SMART
FERM_C 133 221 6.86e-24 SMART
FA 227 273 1.45e-13 SMART
low complexity region 371 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138157
SMART Domains Protein: ENSMUSP00000115136
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155570
SMART Domains Protein: ENSMUSP00000120176
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212518
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Frmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03025:Frmd5 APN 2 121553344 missense probably benign
big_rip UTSW 2 121549218 nonsense probably null
PIT4812001:Frmd5 UTSW 2 121586446 missense probably benign 0.34
R0385:Frmd5 UTSW 2 121555574 missense probably damaging 1.00
R1667:Frmd5 UTSW 2 121548730 frame shift probably null
R4243:Frmd5 UTSW 2 121562882 splice site probably null
R4590:Frmd5 UTSW 2 121765031 splice site probably null
R4705:Frmd5 UTSW 2 121562863 intron probably benign
R4909:Frmd5 UTSW 2 121591653 splice site probably null
R4935:Frmd5 UTSW 2 121562924 missense possibly damaging 0.75
R5008:Frmd5 UTSW 2 121548860 missense probably damaging 1.00
R5095:Frmd5 UTSW 2 121548921 missense possibly damaging 0.95
R5431:Frmd5 UTSW 2 121562909 missense probably damaging 1.00
R5875:Frmd5 UTSW 2 121558478 intron probably benign
R6246:Frmd5 UTSW 2 121551048 missense possibly damaging 0.66
R6404:Frmd5 UTSW 2 121549218 nonsense probably null
R7039:Frmd5 UTSW 2 121547647 unclassified probably benign
R7072:Frmd5 UTSW 2 121557870 missense probably damaging 0.97
R7520:Frmd5 UTSW 2 121554264 critical splice donor site probably null
R7804:Frmd5 UTSW 2 121591744 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGGCTTAGGGACTGCAG -3'
(R):5'- TGTGCTGAGTCACACGAGAG -3'

Sequencing Primer
(F):5'- CTTAGGGACTGCAGCTCGTG -3'
(R):5'- TCACACGAGAGCCTGCAGAG -3'
Posted On2020-09-02