Incidental Mutation 'R8302:Slc12a1'
ID646435
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125190289 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 620 (V620D)
Ref Sequence ENSEMBL: ENSMUSP00000028630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect probably damaging
Transcript: ENSMUST00000028630
AA Change: V620D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: V620D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110494
AA Change: V620D

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: V620D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110495
AA Change: V620D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: V620D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125190204 missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125171257 missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125200622 missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125214132 missense probably benign
R7428:Slc12a1 UTSW 2 125214132 missense probably benign
R7432:Slc12a1 UTSW 2 125206040 missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125217895 nonsense probably null
R7828:Slc12a1 UTSW 2 125166682 missense possibly damaging 0.85
R7862:Slc12a1 UTSW 2 125161094 missense probably damaging 0.99
R7923:Slc12a1 UTSW 2 125214092 missense possibly damaging 0.75
R8020:Slc12a1 UTSW 2 125178102 missense possibly damaging 0.78
R8071:Slc12a1 UTSW 2 125186314 missense probably damaging 1.00
R8272:Slc12a1 UTSW 2 125228816 missense probably damaging 1.00
R8722:Slc12a1 UTSW 2 125160598 missense probably damaging 1.00
RF032:Slc12a1 UTSW 2 125154210 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTAAGAGCTAGGACATGGACC -3'
(R):5'- TGAACTGCCTTGCACACAC -3'

Sequencing Primer
(F):5'- CCAGAGGAGGATTTGTTAACTGCAC -3'
(R):5'- TGCCTTGCACACACTACATGTAAG -3'
Posted On2020-09-02