Incidental Mutation 'R0039:Degs2'
ID64644
Institutional Source Beutler Lab
Gene Symbol Degs2
Ensembl Gene ENSMUSG00000021263
Gene Namedelta(4)-desaturase, sphingolipid 2
SynonymsDes2, 2210008A03Rik
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0039 (G1)
Quality Score130
Status Not validated
Chromosome12
Chromosomal Location108678711-108702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108690589 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 283 (Y283N)
Ref Sequence ENSEMBL: ENSMUSP00000021691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000021691] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000167978] [ENSMUST00000172409] [ENSMUST00000223109]
Predicted Effect probably benign
Transcript: ENSMUST00000021689
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021691
AA Change: Y283N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021691
Gene: ENSMUSG00000021263
AA Change: Y283N

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 65 294 3.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077735
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109854
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167978
SMART Domains Protein: ENSMUSP00000125891
Gene: ENSMUSG00000021263

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 64 275 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172409
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222048
Predicted Effect probably benign
Transcript: ENSMUST00000222255
Predicted Effect probably benign
Transcript: ENSMUST00000223109
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Rreb1 C T 13: 37,899,637 T92M probably damaging Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Degs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Degs2 APN 12 108691995 missense probably damaging 1.00
IGL02755:Degs2 APN 12 108692583 missense probably benign
largo UTSW 12 108692154 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0441:Degs2 UTSW 12 108702214 missense probably damaging 0.97
R1642:Degs2 UTSW 12 108692192 missense probably benign
R4183:Degs2 UTSW 12 108692099 missense probably damaging 1.00
R4817:Degs2 UTSW 12 108689066 nonsense probably null
R6268:Degs2 UTSW 12 108692580 missense probably damaging 1.00
R6863:Degs2 UTSW 12 108702202 missense probably damaging 1.00
R7626:Degs2 UTSW 12 108692073 missense possibly damaging 0.68
R7839:Degs2 UTSW 12 108692201 frame shift probably null
R8356:Degs2 UTSW 12 108691964 missense possibly damaging 0.89
Z1177:Degs2 UTSW 12 108692597 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATCTACTTGCTGGGCACAACAGAC -3'
(R):5'- CCCACTAGACACAGTGATGGCTTC -3'

Sequencing Primer
(F):5'- AGCTGATGCAGGCACAC -3'
(R):5'- GGCAGGAAGACAATCTCTCCAG -3'
Posted On2013-08-06