Incidental Mutation 'R8302:Il17re'
ID646447
Institutional Source Beutler Lab
Gene Symbol Il17re
Ensembl Gene ENSMUSG00000043088
Gene Nameinterleukin 17 receptor E
SynonymsIl25r
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113458484-113470758 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 113466319 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 340 (S340*)
Ref Sequence ENSEMBL: ENSMUSP00000062103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect probably null
Transcript: ENSMUST00000053569
AA Change: S139*
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088
AA Change: S139*

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000058548
AA Change: S340*
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088
AA Change: S340*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101065
AA Change: S139*
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088
AA Change: S139*

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203661
AA Change: S340*
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088
AA Change: S340*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204774
AA Change: S340*
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088
AA Change: S340*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as the receptor for interleukin-17C. The encoded protein signals to downstream components of the mitogen activated protein kinase (MAPK) pathway. Activity of this protein is important in the immune response to bacterial pathogens. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice exhibit increased susceptibility to DSS-induced colitis, imiquimod-induced psoriasis, and C. rodentium bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Il17re
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Il17re APN 6 113469599 missense probably damaging 0.99
IGL01568:Il17re APN 6 113470052 missense probably damaging 1.00
IGL01656:Il17re APN 6 113462973 splice site probably benign
IGL01994:Il17re APN 6 113468450 missense probably benign 0.13
IGL02261:Il17re APN 6 113468511 unclassified probably benign
IGL02699:Il17re APN 6 113468919 missense probably damaging 1.00
PIT4382001:Il17re UTSW 6 113469077 missense probably benign 0.00
R0195:Il17re UTSW 6 113466137 missense probably damaging 1.00
R1901:Il17re UTSW 6 113469704 missense probably damaging 0.98
R2232:Il17re UTSW 6 113464800 missense probably damaging 1.00
R2357:Il17re UTSW 6 113468470 missense possibly damaging 0.55
R2393:Il17re UTSW 6 113462353 missense possibly damaging 0.91
R2916:Il17re UTSW 6 113466028 critical splice donor site probably null
R4820:Il17re UTSW 6 113465855 missense probably benign 0.08
R4951:Il17re UTSW 6 113468907 missense probably damaging 1.00
R4974:Il17re UTSW 6 113469569 missense probably benign 0.14
R5070:Il17re UTSW 6 113459010 missense probably damaging 0.97
R5166:Il17re UTSW 6 113462962 missense probably benign 0.00
R5404:Il17re UTSW 6 113469102 missense probably benign 0.00
R5810:Il17re UTSW 6 113469596 missense probably damaging 1.00
R5916:Il17re UTSW 6 113470123 missense probably damaging 1.00
R6048:Il17re UTSW 6 113470108 missense possibly damaging 0.95
R7432:Il17re UTSW 6 113462371 missense probably benign 0.07
R7548:Il17re UTSW 6 113466387 missense probably damaging 1.00
R7658:Il17re UTSW 6 113458982 missense probably benign 0.23
R7716:Il17re UTSW 6 113462969 critical splice donor site probably null
R7942:Il17re UTSW 6 113466150 missense probably damaging 0.99
R8051:Il17re UTSW 6 113459367 missense probably benign 0.01
R8090:Il17re UTSW 6 113462289 nonsense probably null
Z1177:Il17re UTSW 6 113464792 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGAATGTCCCCACCAGAGTG -3'
(R):5'- TCTATGACAGATGCCGGGATGG -3'

Sequencing Primer
(F):5'- TGGTGAGTCAGTAGGAAATCCCC -3'
(R):5'- GGGCTTTGTGGCTCCAC -3'
Posted On2020-09-02