Incidental Mutation 'R0039:Rreb1'
ID64645
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Nameras responsive element binding protein 1
Synonyms1110037N09Rik, B930013M22Rik
MMRRC Submission 038333-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0039 (G1)
Quality Score100
Status Not validated
Chromosome13
Chromosomal Location37778400-37952005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37899637 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 92 (T92M)
Ref Sequence ENSEMBL: ENSMUSP00000121211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000110237] [ENSMUST00000110238] [ENSMUST00000124373] [ENSMUST00000128570] [ENSMUST00000149745]
Predicted Effect probably damaging
Transcript: ENSMUST00000037232
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: T92M

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110237
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105866
Gene: ENSMUSG00000039087
AA Change: T92M

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110238
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105867
Gene: ENSMUSG00000039087
AA Change: T92M

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect probably damaging
Transcript: ENSMUST00000128570
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: T92M

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149745
AA Change: T92M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121211
Gene: ENSMUSG00000039087
AA Change: T92M

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atic A T 1: 71,577,850 E523V possibly damaging Het
Col18a1 T G 10: 77,077,168 K744N probably damaging Het
Degs2 A T 12: 108,690,589 Y283N probably damaging Het
Eif3m A T 2: 105,005,872 V209E probably damaging Het
Esyt1 A G 10: 128,520,962 V300A probably damaging Het
Gnaz A G 10: 75,015,034 Y297C probably damaging Het
Lmtk2 G T 5: 144,166,387 L321F probably damaging Het
Map3k10 A G 7: 27,658,098 S752P possibly damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mroh8 T C 2: 157,229,929 H552R possibly damaging Het
Rhbdl2 T A 4: 123,810,029 N32K probably benign Het
Specc1 A T 11: 62,029,369 M32L probably damaging Het
Stk31 T C 6: 49,442,258 W700R probably damaging Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 37916496 missense probably benign 0.09
IGL00336:Rreb1 APN 13 37929646 nonsense probably null
IGL00473:Rreb1 APN 13 37930791 nonsense probably null
IGL01338:Rreb1 APN 13 37931034 missense probably damaging 1.00
IGL01836:Rreb1 APN 13 37931457 missense probably damaging 1.00
IGL02066:Rreb1 APN 13 37931506 missense probably benign 0.16
IGL02661:Rreb1 APN 13 37930802 nonsense probably null
IGL02739:Rreb1 APN 13 37893821 missense probably damaging 1.00
IGL03267:Rreb1 APN 13 37932193 missense probably benign 0.30
IGL03332:Rreb1 APN 13 37930916 missense probably benign 0.42
IGL03403:Rreb1 APN 13 37929574 missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0101:Rreb1 UTSW 13 37931542 missense probably benign 0.04
R0265:Rreb1 UTSW 13 37916155 nonsense probably null
R0635:Rreb1 UTSW 13 37941564 missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 37932231 missense probably benign 0.09
R1099:Rreb1 UTSW 13 37948891 missense probably benign 0.16
R1438:Rreb1 UTSW 13 37930605 missense probably benign 0.16
R1457:Rreb1 UTSW 13 37946928 missense possibly damaging 0.52
R1510:Rreb1 UTSW 13 37931884 missense probably benign 0.04
R1672:Rreb1 UTSW 13 37930537 missense probably benign 0.09
R1772:Rreb1 UTSW 13 37930923 missense probably benign 0.09
R2171:Rreb1 UTSW 13 37930846 missense probably benign 0.00
R2371:Rreb1 UTSW 13 37916537 missense probably benign 0.09
R2566:Rreb1 UTSW 13 37929792 missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R2862:Rreb1 UTSW 13 37932453 missense probably benign 0.02
R2874:Rreb1 UTSW 13 37916508 missense probably benign 0.09
R2911:Rreb1 UTSW 13 37948920 missense probably benign 0.00
R3722:Rreb1 UTSW 13 37947098 missense probably benign 0.01
R3767:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3886:Rreb1 UTSW 13 37898506 splice site probably null
R3887:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3888:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3889:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R4064:Rreb1 UTSW 13 37930317 missense probably benign 0.42
R4134:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4135:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4174:Rreb1 UTSW 13 37930150 missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 37893893 missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 37931931 missense probably benign 0.03
R4396:Rreb1 UTSW 13 37930443 nonsense probably null
R4658:Rreb1 UTSW 13 37948801 missense probably damaging 1.00
R4841:Rreb1 UTSW 13 37916526 missense probably benign 0.09
R4856:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 37928278 missense probably benign 0.09
R5122:Rreb1 UTSW 13 37930768 missense probably benign 0.02
R5405:Rreb1 UTSW 13 37949111 missense probably damaging 0.99
R5408:Rreb1 UTSW 13 37931344 missense probably benign 0.01
R5446:Rreb1 UTSW 13 37898497 missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 37947421 missense probably benign 0.00
R5859:Rreb1 UTSW 13 37947408 missense probably benign 0.24
R5859:Rreb1 UTSW 13 37947409 missense probably benign 0.06
R6429:Rreb1 UTSW 13 37932129 missense probably benign 0.03
R6678:Rreb1 UTSW 13 37899699 missense probably damaging 1.00
R7130:Rreb1 UTSW 13 37899748 missense probably damaging 1.00
R7186:Rreb1 UTSW 13 37941632 missense probably benign 0.02
R7188:Rreb1 UTSW 13 37916568 missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 37947064 missense unknown
R7453:Rreb1 UTSW 13 37941569 missense probably damaging 0.98
R7492:Rreb1 UTSW 13 37931748 missense probably benign 0.00
R7585:Rreb1 UTSW 13 37893898 missense probably benign 0.07
R7621:Rreb1 UTSW 13 37949066 missense
R7645:Rreb1 UTSW 13 37931034 missense probably damaging 1.00
R7653:Rreb1 UTSW 13 37930386 missense probably benign 0.19
R7670:Rreb1 UTSW 13 37931572 missense probably benign 0.00
R7701:Rreb1 UTSW 13 37930116 missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 37929570 missense probably benign 0.18
R7874:Rreb1 UTSW 13 37947124 missense probably damaging 1.00
R8103:Rreb1 UTSW 13 37941701 missense probably benign 0.16
R8129:Rreb1 UTSW 13 37929799 missense probably benign 0.00
R8239:Rreb1 UTSW 13 37893872 missense probably damaging 1.00
R8324:Rreb1 UTSW 13 37947621 missense probably damaging 1.00
R8824:Rreb1 UTSW 13 37930516 missense probably damaging 0.99
X0024:Rreb1 UTSW 13 37931580 missense probably benign 0.09
X0026:Rreb1 UTSW 13 37931992 missense probably benign 0.17
Z1088:Rreb1 UTSW 13 37948937 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGCCTCCCAGTGTGTAAAC -3'
(R):5'- ACTAATGGCTCAATGGTGCAGTCAG -3'

Sequencing Primer
(F):5'- ATAGTTAAGACTCCTCCTGTCCAGAG -3'
(R):5'- TGCAGTCAGCCACCCAAG -3'
Posted On2013-08-06