Incidental Mutation 'R8302:Atg5'
ID646456
Institutional Source Beutler Lab
Gene Symbol Atg5
Ensembl Gene ENSMUSG00000038160
Gene Nameautophagy related 5
SynonymsPaddy, 3110067M24Rik, Apg5l, 2010107M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location44268358-44364291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44286119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 10 (D10E)
Ref Sequence ENSEMBL: ENSMUSP00000044769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039286]
Predicted Effect probably benign
Transcript: ENSMUST00000039286
AA Change: D10E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000044769
Gene: ENSMUSG00000038160
AA Change: D10E

DomainStartEndE-ValueType
Pfam:APG5 79 270 2.6e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Two transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene results in impaired autophagy due to absence of autolysosomes. Homozygotes die within 1 day of birth, have shorter survival times and reduced amino acid levels under fasting conditions. Homozygotes for a gene trap insertion mutationin this gene show no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Atg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Atg5 APN 10 44363044 missense probably benign 0.00
P0041:Atg5 UTSW 10 44289942 missense probably benign 0.20
R2094:Atg5 UTSW 10 44319548 missense probably damaging 1.00
R4906:Atg5 UTSW 10 44363050 makesense probably null
R5718:Atg5 UTSW 10 44362987 missense probably benign 0.01
R6194:Atg5 UTSW 10 44294616 missense probably damaging 1.00
R6660:Atg5 UTSW 10 44294655 missense probably benign
R7070:Atg5 UTSW 10 44286154 missense probably damaging 1.00
R7677:Atg5 UTSW 10 44347039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTACATCAGTGAGGCCTC -3'
(R):5'- GCGTCAGGATGTATCATATGAGC -3'

Sequencing Primer
(F):5'- TCAGTGAGGCCTCCCCATAC -3'
(R):5'- GGGTGGATGGAGAAAATATCGC -3'
Posted On2020-09-02