Incidental Mutation 'R8302:Psma6'
ID646461
Institutional Source Beutler Lab
Gene Symbol Psma6
Ensembl Gene ENSMUSG00000021024
Gene Nameproteasome (prosome, macropain) subunit, alpha type 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location55384222-55418454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55410181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 103 (Y103F)
Ref Sequence ENSEMBL: ENSMUSP00000021412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021412] [ENSMUST00000162711] [ENSMUST00000163070]
PDB Structure Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021412
AA Change: Y103F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000021412
Gene: ENSMUSG00000021024
AA Change: Y103F

DomainStartEndE-ValueType
Proteasome_A_N 9 31 3.21e-9 SMART
Pfam:Proteasome 32 220 3.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162711
SMART Domains Protein: ENSMUSP00000123914
Gene: ENSMUSG00000021024

DomainStartEndE-ValueType
Pfam:Proteasome_A_N 9 25 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163070
AA Change: Y84F

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124781
Gene: ENSMUSG00000021024
AA Change: Y84F

DomainStartEndE-ValueType
Pfam:Proteasome 13 201 1.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Slc9c1 T C 16: 45,547,695 F216L probably benign Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Psma6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Psma6 APN 12 55407469 missense probably damaging 1.00
IGL02658:Psma6 APN 12 55412211 missense probably benign 0.07
IGL02991:Psma6 APN 12 55407572 splice site probably benign
R0761:Psma6 UTSW 12 55412342 missense possibly damaging 0.87
R1758:Psma6 UTSW 12 55407532 missense probably damaging 0.99
R2103:Psma6 UTSW 12 55408057 missense probably benign 0.23
R2897:Psma6 UTSW 12 55408044 missense probably benign 0.00
R5333:Psma6 UTSW 12 55407428 intron probably benign
R5782:Psma6 UTSW 12 55410256 missense possibly damaging 0.68
R7432:Psma6 UTSW 12 55398828 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCATGCCAAGTCACTCAGTG -3'
(R):5'- GGCCGCAGTTTCTTTATACATGC -3'

Sequencing Primer
(F):5'- AAGCCACAGAGAACCCTTGTTTTTC -3'
(R):5'- TGCTCTCTATAGACAATCACAACTCG -3'
Posted On2020-09-02