Incidental Mutation 'R8302:Slc9c1'
ID646471
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R8302 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45547695 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 216 (F216L)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: F216L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: F216L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C T 11: 109,962,580 probably null Het
Ank3 T C 10: 70,004,980 S1937P possibly damaging Het
Atg5 T A 10: 44,286,119 D10E probably benign Het
Car12 A G 9: 66,747,597 D103G probably benign Het
Cpa3 A G 3: 20,222,152 Y306H probably damaging Het
Cyp2c40 A G 19: 39,807,622 V104A probably damaging Het
Cyp2c66 A T 19: 39,176,634 H353L probably damaging Het
Cyp2d22 A G 15: 82,371,820 probably null Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Exph5 A G 9: 53,376,476 E1619G possibly damaging Het
Frmd5 T A 2: 121,547,579 T435S unknown Het
Gm3371 T C 14: 44,403,724 R128G Het
Gper1 A G 5: 139,426,275 D125G probably benign Het
Il17re C A 6: 113,466,319 S340* probably null Het
Kazald1 T A 19: 45,076,839 L53Q probably damaging Het
Kdm3b A T 18: 34,834,335 H1731L probably damaging Het
Kif20a T C 18: 34,631,977 S755P probably damaging Het
Lrch1 T C 14: 74,795,332 N526S probably benign Het
Map3k8 T C 18: 4,334,064 I343V probably damaging Het
Nabp1 A T 1: 51,472,339 F140L probably benign Het
Ncor1 A G 11: 62,333,855 S860P probably benign Het
Ndufaf5 T A 2: 140,188,778 Y195N possibly damaging Het
Nsfl1c T C 2: 151,504,136 L157P probably damaging Het
Olfr1199 T A 2: 88,756,643 I11F possibly damaging Het
Olfr170 T A 16: 19,606,366 I100L probably benign Het
Olfr994 T A 2: 85,430,086 T248S possibly damaging Het
Pcdh10 A G 3: 45,381,498 Y749C probably damaging Het
Plcz1 T A 6: 140,028,437 K93I probably damaging Het
Plpbp T C 8: 27,049,188 S109P Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma6 A T 12: 55,410,181 Y103F probably benign Het
Ptpn3 A G 4: 57,218,514 F650L probably benign Het
Pxk T C 14: 8,164,094 F562S probably damaging Het
Rbl2 A G 8: 91,085,445 D214G probably damaging Het
Rgs17 C T 10: 5,862,525 C58Y possibly damaging Het
Rnf6 A T 5: 146,211,524 V228E probably benign Het
Sardh T C 2: 27,215,110 D667G probably benign Het
Slc12a1 T A 2: 125,190,289 V620D probably damaging Het
Slc39a7 A G 17: 34,030,712 I153T probably damaging Het
Slc5a11 T C 7: 123,247,939 V125A probably damaging Het
Strip1 A T 3: 107,625,708 I208N probably damaging Het
Top1 T C 2: 160,703,576 M288T probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trmt2a T C 16: 18,249,949 V162A probably damaging Het
Wdr35 T C 12: 9,028,110 I1167T probably benign Het
Wdr76 C A 2: 121,510,563 H30N probably benign Het
Zan A G 5: 137,409,661 S3624P unknown Het
Zc3h7a T C 16: 11,137,385 K942E probably damaging Het
Zfp292 A G 4: 34,810,893 V722A possibly damaging Het
Zfp943 A G 17: 21,992,110 H59R probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGGAAGAAAACTGCTAGAC -3'
(R):5'- TGATCCTCTGGGAAGCTTCAC -3'

Sequencing Primer
(F):5'- CAGATGAGAACCCATGGTTAATG -3'
(R):5'- TCTGGGAAGCTTCACCCCAG -3'
Posted On2020-09-02