Incidental Mutation 'R8372:Ptprk'
ID646501
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8372 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28354692 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 260 (T260A)
Ref Sequence ENSEMBL: ENSMUSP00000126279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166468
AA Change: T260A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: T260A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: T260A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218359
AA Change: T260A

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,288 D155G probably damaging Het
Adgrg7 T A 16: 56,795,751 probably benign Het
Agap2 T C 10: 127,089,316 S833P unknown Het
B4galnt2 T C 11: 95,869,280 E307G possibly damaging Het
Bcl9l A G 9: 44,507,231 M826V probably benign Het
C2cd3 C T 7: 100,455,280 Q2167* probably null Het
Ccdc7a T C 8: 128,821,104 E1289G possibly damaging Het
Cep290 T C 10: 100,549,341 V1893A probably benign Het
Clec4g T C 8: 3,707,990 probably benign Het
Cspg4 A G 9: 56,887,195 E738G probably damaging Het
Cyth4 A G 15: 78,597,135 probably benign Het
Dab2 A C 15: 6,416,925 S8R possibly damaging Het
Dclk3 A G 9: 111,485,013 D719G probably damaging Het
Dync2h1 A G 9: 7,111,514 V2540A possibly damaging Het
Elavl1 T C 8: 4,289,664 N306S probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Fcgr2b A G 1: 170,965,761 V233A probably benign Het
Gfm2 T C 13: 97,165,044 S452P possibly damaging Het
Gm10229 G C 16: 89,015,497 G57R unknown Het
Gpr15 A G 16: 58,718,487 F80L probably benign Het
Ighv13-2 A T 12: 114,358,061 C19* probably null Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Klhl9 A G 4: 88,721,359 L215P probably damaging Het
Olfr826 A G 10: 130,180,787 F31S probably damaging Het
Parp8 T A 13: 116,855,250 Q872H probably damaging Het
Plxnb2 A G 15: 89,158,493 S1531P probably damaging Het
Psg16 A G 7: 17,095,315 T275A probably benign Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rbm15b T C 9: 106,885,563 M19V Het
Rbm42 A G 7: 30,641,206 S447P unknown Het
Rsf1 T C 7: 97,662,417 S785P Het
Scnn1a A G 6: 125,343,718 N578S probably damaging Het
Slc39a7 T C 17: 34,030,665 N169D probably damaging Het
Spp1 A G 5: 104,440,256 T175A probably benign Het
Tigd5 A G 15: 75,910,488 H233R probably benign Het
Tmprss3 C T 17: 31,184,697 V377I probably benign Het
Vmn1r75 A T 7: 11,880,730 I130F probably benign Het
Xpo4 A G 14: 57,597,884 probably null Het
Xrn1 A G 9: 96,024,113 T1186A probably benign Het
Zcchc4 T C 5: 52,796,164 Y172H probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACACAGGCATCTTTCATATAG -3'
(R):5'- TGCAATGACGAATACTGCAGC -3'

Sequencing Primer
(F):5'- GGCATCTTTCATATAGTTTAGCAACC -3'
(R):5'- TGCAGCTTAAAAACCAGTCACTGTG -3'
Posted On2020-09-02