Incidental Mutation 'R8372:B4galnt2'
ID 646505
Institutional Source Beutler Lab
Gene Symbol B4galnt2
Ensembl Gene ENSMUSG00000013418
Gene Name beta-1,4-N-acetyl-galactosaminyl transferase 2
Synonyms Galgt2, Dlb-1, Dlb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8372 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 95865943-95914891 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95869280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 307 (E307G)
Ref Sequence ENSEMBL: ENSMUSP00000037239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038343]
AlphaFold Q09199
Predicted Effect possibly damaging
Transcript: ENSMUST00000038343
AA Change: E307G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037239
Gene: ENSMUSG00000013418
AA Change: E307G

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
Pfam:Glycos_transf_2 268 433 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT2 catalyzes the last step in the biosynthesis of the human Sd(a) antigen through the addition of an N-acetylgalactosamine residue via a beta-1,4 linkage to a subterminal galactose residue substituted with an alpha-2,3-linked sialic acid. B4GALNT2 also catalyzes the last step in the biosynthesis of the Cad antigen (Montiel et al., 2003 [PubMed 12678917]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele show increased startle reflex, increased systemic arterial diastolic blood pressure, abnormal B cell number, increased neutrophil cell number, and increased circulating alkaline phosphatase level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,288 D155G probably damaging Het
Adgrg7 T A 16: 56,795,751 probably benign Het
Agap2 T C 10: 127,089,316 S833P unknown Het
Bcl9l A G 9: 44,507,231 M826V probably benign Het
C2cd3 C T 7: 100,455,280 Q2167* probably null Het
Ccdc7a T C 8: 128,821,104 E1289G possibly damaging Het
Cep290 T C 10: 100,549,341 V1893A probably benign Het
Clec4g T C 8: 3,707,990 probably benign Het
Cspg4 A G 9: 56,887,195 E738G probably damaging Het
Cyth4 A G 15: 78,597,135 probably benign Het
Dab2 A C 15: 6,416,925 S8R possibly damaging Het
Dclk3 A G 9: 111,485,013 D719G probably damaging Het
Dync2h1 A G 9: 7,111,514 V2540A possibly damaging Het
Elavl1 T C 8: 4,289,664 N306S probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Fcgr2b A G 1: 170,965,761 V233A probably benign Het
Gfm2 T C 13: 97,165,044 S452P possibly damaging Het
Gm10229 G C 16: 89,015,497 G57R unknown Het
Gpr15 A G 16: 58,718,487 F80L probably benign Het
Ighv13-2 A T 12: 114,358,061 C19* probably null Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Klhl9 A G 4: 88,721,359 L215P probably damaging Het
Olfr826 A G 10: 130,180,787 F31S probably damaging Het
Parp8 T A 13: 116,855,250 Q872H probably damaging Het
Plxnb2 A G 15: 89,158,493 S1531P probably damaging Het
Psg16 A G 7: 17,095,315 T275A probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rbm15b T C 9: 106,885,563 M19V Het
Rbm42 A G 7: 30,641,206 S447P unknown Het
Rsf1 T C 7: 97,662,417 S785P Het
Scnn1a A G 6: 125,343,718 N578S probably damaging Het
Slc39a7 T C 17: 34,030,665 N169D probably damaging Het
Spp1 A G 5: 104,440,256 T175A probably benign Het
Tigd5 A G 15: 75,910,488 H233R probably benign Het
Tmprss3 C T 17: 31,184,697 V377I probably benign Het
Vmn1r75 A T 7: 11,880,730 I130F probably benign Het
Xpo4 A G 14: 57,597,884 probably null Het
Xrn1 A G 9: 96,024,113 T1186A probably benign Het
Zcchc4 T C 5: 52,796,164 Y172H probably damaging Het
Other mutations in B4galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03252:B4galnt2 APN 11 95873931 missense probably damaging 0.99
R0594:B4galnt2 UTSW 11 95891909 missense probably benign 0.00
R1216:B4galnt2 UTSW 11 95891941 missense probably benign 0.02
R1344:B4galnt2 UTSW 11 95869355 missense probably benign 0.43
R1735:B4galnt2 UTSW 11 95890983 missense probably damaging 0.99
R4706:B4galnt2 UTSW 11 95876097 critical splice donor site probably null
R4707:B4galnt2 UTSW 11 95876097 critical splice donor site probably null
R4867:B4galnt2 UTSW 11 95868426 missense probably damaging 1.00
R4937:B4galnt2 UTSW 11 95868429 missense probably damaging 1.00
R4967:B4galnt2 UTSW 11 95869274 missense probably benign 0.19
R5077:B4galnt2 UTSW 11 95876314 intron probably benign
R5822:B4galnt2 UTSW 11 95866159 missense probably damaging 1.00
R6225:B4galnt2 UTSW 11 95868442 missense probably damaging 1.00
R6239:B4galnt2 UTSW 11 95876239 missense probably damaging 0.99
R6653:B4galnt2 UTSW 11 95891921 missense probably benign
R6747:B4galnt2 UTSW 11 95868634 splice site probably null
R6969:B4galnt2 UTSW 11 95891930 missense probably benign 0.02
R7448:B4galnt2 UTSW 11 95869367 missense probably damaging 1.00
R7879:B4galnt2 UTSW 11 95869397 missense possibly damaging 0.87
R8397:B4galnt2 UTSW 11 95866163 missense probably benign 0.00
R8966:B4galnt2 UTSW 11 95890985 missense probably damaging 1.00
X0009:B4galnt2 UTSW 11 95891061 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTTTCCCTCTGCATCAGAAC -3'
(R):5'- GGGCTCTAGCATCCACTTTTAC -3'

Sequencing Primer
(F):5'- GTTTCCCTCTGCATCAGAACAAGAG -3'
(R):5'- GCATCCACTTTTACACTCTTCTCTAG -3'
Posted On 2020-09-02