Incidental Mutation 'R8372:Cyth4'
ID646514
Institutional Source Beutler Lab
Gene Symbol Cyth4
Ensembl Gene ENSMUSG00000018008
Gene Namecytohesin 4
Synonyms5830469K17Rik, 2510004M07Rik, Pscd4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8372 (G1)
Quality Score183.009
Status Not validated
Chromosome15
Chromosomal Location78597047-78622019 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 78597135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043069] [ENSMUST00000229248] [ENSMUST00000229256] [ENSMUST00000229295] [ENSMUST00000229717] [ENSMUST00000229796] [ENSMUST00000231168] [ENSMUST00000231180]
Predicted Effect probably benign
Transcript: ENSMUST00000043069
SMART Domains Protein: ENSMUSP00000042698
Gene: ENSMUSG00000018008

DomainStartEndE-ValueType
Sec7 58 243 1.05e-90 SMART
PH 260 377 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229248
Predicted Effect probably benign
Transcript: ENSMUST00000229256
Predicted Effect probably benign
Transcript: ENSMUST00000229295
Predicted Effect probably benign
Transcript: ENSMUST00000229717
Predicted Effect probably benign
Transcript: ENSMUST00000229796
Predicted Effect probably benign
Transcript: ENSMUST00000231168
Predicted Effect probably benign
Transcript: ENSMUST00000231180
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD family of proteins, which have an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family function as GEPs for ADP-ribosylation factors (ARFs), which are guanine nucleotide-binding proteins involved in vesicular trafficking pathways. This protein exhibits GEP activity in vitro with ARF1 and ARF5, but is inactive with ARF6. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,288 D155G probably damaging Het
Adgrg7 T A 16: 56,795,751 probably benign Het
Agap2 T C 10: 127,089,316 S833P unknown Het
B4galnt2 T C 11: 95,869,280 E307G possibly damaging Het
Bcl9l A G 9: 44,507,231 M826V probably benign Het
C2cd3 C T 7: 100,455,280 Q2167* probably null Het
Ccdc7a T C 8: 128,821,104 E1289G possibly damaging Het
Cep290 T C 10: 100,549,341 V1893A probably benign Het
Clec4g T C 8: 3,707,990 probably benign Het
Cspg4 A G 9: 56,887,195 E738G probably damaging Het
Dab2 A C 15: 6,416,925 S8R possibly damaging Het
Dclk3 A G 9: 111,485,013 D719G probably damaging Het
Dync2h1 A G 9: 7,111,514 V2540A possibly damaging Het
Elavl1 T C 8: 4,289,664 N306S probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Fcgr2b A G 1: 170,965,761 V233A probably benign Het
Gfm2 T C 13: 97,165,044 S452P possibly damaging Het
Gm10229 G C 16: 89,015,497 G57R unknown Het
Gpr15 A G 16: 58,718,487 F80L probably benign Het
Ighv13-2 A T 12: 114,358,061 C19* probably null Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Klhl9 A G 4: 88,721,359 L215P probably damaging Het
Olfr826 A G 10: 130,180,787 F31S probably damaging Het
Parp8 T A 13: 116,855,250 Q872H probably damaging Het
Plxnb2 A G 15: 89,158,493 S1531P probably damaging Het
Psg16 A G 7: 17,095,315 T275A probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rbm15b T C 9: 106,885,563 M19V Het
Rbm42 A G 7: 30,641,206 S447P unknown Het
Rsf1 T C 7: 97,662,417 S785P Het
Scnn1a A G 6: 125,343,718 N578S probably damaging Het
Slc39a7 T C 17: 34,030,665 N169D probably damaging Het
Spp1 A G 5: 104,440,256 T175A probably benign Het
Tigd5 A G 15: 75,910,488 H233R probably benign Het
Tmprss3 C T 17: 31,184,697 V377I probably benign Het
Vmn1r75 A T 7: 11,880,730 I130F probably benign Het
Xpo4 A G 14: 57,597,884 probably null Het
Xrn1 A G 9: 96,024,113 T1186A probably benign Het
Zcchc4 T C 5: 52,796,164 Y172H probably damaging Het
Other mutations in Cyth4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Cyth4 APN 15 78619913 missense probably benign 0.00
R0522:Cyth4 UTSW 15 78615785 missense possibly damaging 0.67
R0584:Cyth4 UTSW 15 78609878 splice site probably null
R2018:Cyth4 UTSW 15 78608171 missense probably damaging 1.00
R3804:Cyth4 UTSW 15 78609802 missense probably damaging 1.00
R3811:Cyth4 UTSW 15 78604649 missense probably damaging 1.00
R4728:Cyth4 UTSW 15 78602713 missense probably benign 0.01
R4738:Cyth4 UTSW 15 78605874 missense probably benign 0.02
R5392:Cyth4 UTSW 15 78606985 missense probably damaging 1.00
R5594:Cyth4 UTSW 15 78607075 splice site probably null
R6414:Cyth4 UTSW 15 78608146 missense probably damaging 0.97
R7241:Cyth4 UTSW 15 78607045 missense probably benign 0.38
R7472:Cyth4 UTSW 15 78605894 missense probably damaging 1.00
R8253:Cyth4 UTSW 15 78602737 missense probably benign 0.09
Z1177:Cyth4 UTSW 15 78619919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTACTCAGATGCCAGGGTC -3'
(R):5'- CAACCACTCAGATGCCTGTG -3'

Sequencing Primer
(F):5'- GTCTGAGCTAACTGGTGAAACTC -3'
(R):5'- CTACCTCTGCACATGGAGTTTGAG -3'
Posted On2020-09-02