Incidental Mutation 'R8373:Dpp10'
ID 646525
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 123259871-124773774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123781958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000112603
AA Change: S63P

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: S63P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112606
AA Change: S74P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: S74P

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc1 T C 3: 19,203,731 (GRCm39) Y65C probably damaging Het
Armc8 A G 9: 99,409,152 (GRCm39) V222A probably benign Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Kif3c G T 12: 3,416,089 (GRCm39) V37L probably benign Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Mpp7 A G 18: 7,444,096 (GRCm39) S109P probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Ptch1 A G 13: 63,688,982 (GRCm39) Y432H probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123,262,099 (GRCm39) missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123,295,596 (GRCm39) missense probably benign
IGL02101:Dpp10 APN 1 123,339,555 (GRCm39) missense probably damaging 1.00
IGL02284:Dpp10 APN 1 123,973,103 (GRCm39) splice site probably benign
IGL02324:Dpp10 APN 1 123,295,531 (GRCm39) missense probably benign 0.02
IGL02391:Dpp10 APN 1 123,578,087 (GRCm39) missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123,269,418 (GRCm39) missense probably benign 0.01
IGL02469:Dpp10 APN 1 123,339,532 (GRCm39) missense probably benign 0.01
IGL02501:Dpp10 APN 1 123,613,999 (GRCm39) missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123,351,381 (GRCm39) missense probably benign 0.24
IGL02672:Dpp10 APN 1 123,304,376 (GRCm39) missense probably benign 0.45
IGL03034:Dpp10 APN 1 123,269,348 (GRCm39) missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123,268,911 (GRCm39) splice site probably benign
R0104:Dpp10 UTSW 1 123,295,572 (GRCm39) missense probably benign 0.00
R0114:Dpp10 UTSW 1 123,413,821 (GRCm39) missense probably benign 0.07
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123,832,852 (GRCm39) missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123,360,658 (GRCm39) critical splice donor site probably null
R1549:Dpp10 UTSW 1 123,269,109 (GRCm39) critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123,372,935 (GRCm39) missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123,281,333 (GRCm39) missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R1992:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R2079:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123,372,932 (GRCm39) missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123,339,434 (GRCm39) splice site probably benign
R3827:Dpp10 UTSW 1 123,339,519 (GRCm39) missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123,413,653 (GRCm39) nonsense probably null
R3876:Dpp10 UTSW 1 123,281,216 (GRCm39) missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123,281,286 (GRCm39) missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123,326,356 (GRCm39) missense probably benign 0.15
R4922:Dpp10 UTSW 1 123,305,882 (GRCm39) missense probably benign 0.44
R5457:Dpp10 UTSW 1 123,339,539 (GRCm39) missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123,832,803 (GRCm39) missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123,312,018 (GRCm39) missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123,312,012 (GRCm39) critical splice donor site probably null
R6378:Dpp10 UTSW 1 123,339,468 (GRCm39) missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123,295,330 (GRCm39) missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123,264,580 (GRCm39) missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123,295,385 (GRCm39) nonsense probably null
R6894:Dpp10 UTSW 1 123,264,593 (GRCm39) missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123,269,379 (GRCm39) missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123,268,880 (GRCm39) missense probably benign 0.15
R7246:Dpp10 UTSW 1 123,262,106 (GRCm39) missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123,281,157 (GRCm39) nonsense probably null
R7375:Dpp10 UTSW 1 123,295,524 (GRCm39) missense probably benign
R7387:Dpp10 UTSW 1 123,268,869 (GRCm39) missense probably benign 0.01
R7661:Dpp10 UTSW 1 123,312,681 (GRCm39) missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8067:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8260:Dpp10 UTSW 1 123,614,024 (GRCm39) missense probably benign
R8324:Dpp10 UTSW 1 123,781,901 (GRCm39) missense probably benign 0.02
R8434:Dpp10 UTSW 1 123,360,739 (GRCm39) missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123,360,667 (GRCm39) missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123,339,484 (GRCm39) missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123,304,370 (GRCm39) missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123,281,159 (GRCm39) missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123,264,611 (GRCm39) missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123,269,409 (GRCm39) missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123,269,432 (GRCm39) missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123,262,088 (GRCm39) missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123,326,314 (GRCm39) missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123,326,311 (GRCm39) missense probably benign 0.36
X0021:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123,312,015 (GRCm39) missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123,281,169 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTACACCACAGTCAGTTCTAC -3'
(R):5'- TGGGCCTTCTTGAATAGTGC -3'

Sequencing Primer
(F):5'- TGATTCTAGGATGAGCTACA -3'
(R):5'- AGGGTAGTCTGGATTTCATAAGACCC -3'
Posted On 2020-09-02