Mutagenetix > Incidental Mutations

Incidental Mutation 'R8373:Rapgef1'

646528

Institutional Source

Beutler Lab

Gene Symbol

Rapgef1

Ensembl Gene

ENSMUSG00000039844

Gene Name

Rap guanine nucleotide exchange factor (GEF) 1

Synonyms

Grf2, 4932418O06Rik, C3G

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8373 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29619720-29740978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 29710231 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 655 (G655S)

Ref Sequence

ENSEMBL: ENSMUSP00000092703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]

Predicted Effect

probably benign
Transcript: ENSMUST00000091146
AA Change: G617S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: G617S

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	664	682	N/A	INTRINSIC
low complexity region	689	700	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
RasGEFN	828	970	8.04e-37	SMART
RasGEF	977	1206	5.85e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095087
AA Change: G655S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: G655S

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
low complexity region	702	720	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
RasGEFN	834	976	8.04e-37	SMART
RasGEF	983	1212	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102872

SMART Domains

Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
RasGEFN	696	838	8.04e-37	SMART
RasGEF	845	1074	5.85e-102	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844
AA Change: G159S

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC
low complexity region	54	65	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
RasGEFN	253	395	8.04e-37	SMART
RasGEF	402	631	5.85e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147755
AA Change: G616S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: G616S

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	591	602	N/A	INTRINSIC
low complexity region	663	681	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	G	6: 41,031,688	T231P	possibly damaging	Het
Adgrg6	T	C	10: 14,467,334	T290A	probably benign	Het
Aff4	C	T	11: 53,400,267	Q685*	probably null	Het
Ankmy1	A	G	1: 92,896,094	M150T	probably damaging	Het
Armc1	T	C	3: 19,149,567	Y65C	probably damaging	Het
Armc8	A	G	9: 99,527,099	V222A	probably benign	Het
Bcar1	A	T	8: 111,715,738	Y228*	probably null	Het
Cct2	T	C	10: 117,060,824	D158G	possibly damaging	Het
Cul1	T	A	6: 47,515,063	C426S	possibly damaging	Het
Deup1	G	T	9: 15,592,375	L297M	possibly damaging	Het
Dpp10	A	G	1: 123,854,229	S74P	possibly damaging	Het
Epha4	A	G	1: 77,507,079	Y98H	possibly damaging	Het
Epn3	T	G	11: 94,492,936	D296A	probably damaging	Het
Eri2	A	C	7: 119,772,597	I252S	probably benign	Het
Gm14025	T	A	2: 129,038,171	I612F		Het
Gp9	C	T	6: 87,779,012	T3I	probably benign	Het
H2-Q5	T	A	17: 35,394,456	V55E		Het
Kif3c	G	T	12: 3,366,089	V37L	probably benign	Het
Lct	A	T	1: 128,303,840	N757K	probably damaging	Het
Lhx8	A	C	3: 154,324,658	N112K	probably damaging	Het
Loxl3	T	A	6: 83,048,891	S373R	possibly damaging	Het
Mettl4	G	A	17: 94,733,649	T359I	probably damaging	Het
Mpp7	A	G	18: 7,444,096	S109P	probably damaging	Het
Nckap5	A	G	1: 126,026,295	V840A	probably benign	Het
Ncoa4	T	A	14: 32,176,936	L571Q	probably damaging	Het
Olfr453	T	C	6: 42,744,346	F103S	probably damaging	Het
Olfr46	A	T	7: 140,610,295	Y35F	possibly damaging	Het
Phgdh	G	A	3: 98,321,245	T204I	probably damaging	Het
Pla2g4d	C	T	2: 120,277,499	V310M	probably null	Het
Psmd12	C	T	11: 107,497,624	P421L	probably damaging	Het
Ptch1	A	G	13: 63,541,168	Y432H	probably damaging	Het
Rilpl2	C	A	5: 124,478,034	A18S	probably damaging	Het
Srsf7	T	C	17: 80,205,386	R88G	probably benign	Het
St6galnac1	T	C	11: 116,769,233	K85E	possibly damaging	Het
Trip12	A	T	1: 84,795,767	S49R	probably damaging	Het
Wdr48	A	G	9: 119,905,494	T160A	probably damaging	Het
Zfp704	G	A	3: 9,609,442	T93M	unknown	Het

Other mutations in Rapgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Rapgef1	APN	2	29722269	missense	probably benign
IGL00917:Rapgef1	APN	2	29702523	missense	probably benign	0.00
IGL02618:Rapgef1	APN	2	29737943	missense	probably damaging	1.00
IGL02642:Rapgef1	APN	2	29700860	splice site	probably benign
IGL02974:Rapgef1	APN	2	29710216	missense	possibly damaging	0.64
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0279:Rapgef1	UTSW	2	29726227	missense	probably damaging	1.00
R0432:Rapgef1	UTSW	2	29679816	missense	possibly damaging	0.86
R1817:Rapgef1	UTSW	2	29686256	missense	probably damaging	1.00
R1837:Rapgef1	UTSW	2	29737426	missense	probably damaging	1.00
R1970:Rapgef1	UTSW	2	29733711	missense	probably damaging	1.00
R1980:Rapgef1	UTSW	2	29722227	missense	probably benign
R2076:Rapgef1	UTSW	2	29702508	missense	probably benign	0.00
R2363:Rapgef1	UTSW	2	29736596	missense	possibly damaging	0.63
R3016:Rapgef1	UTSW	2	29707393	missense	probably damaging	1.00
R3053:Rapgef1	UTSW	2	29724856	missense	probably damaging	1.00
R3777:Rapgef1	UTSW	2	29719689	missense	possibly damaging	0.67
R3980:Rapgef1	UTSW	2	29719650	missense	probably benign	0.33
R4491:Rapgef1	UTSW	2	29719656	missense	possibly damaging	0.93
R4524:Rapgef1	UTSW	2	29679246	missense	probably benign	0.00
R4732:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R4733:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R5391:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5395:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5611:Rapgef1	UTSW	2	29702436	missense	probably damaging	0.96
R6062:Rapgef1	UTSW	2	29700732	missense	probably damaging	0.96
R6145:Rapgef1	UTSW	2	29736666	missense	probably damaging	1.00
R6580:Rapgef1	UTSW	2	29730609	missense	possibly damaging	0.95
R6892:Rapgef1	UTSW	2	29699840	critical splice donor site	probably null
R6897:Rapgef1	UTSW	2	29702502	missense	probably damaging	1.00
R6957:Rapgef1	UTSW	2	29733698	missense	possibly damaging	0.62
R7039:Rapgef1	UTSW	2	29726214	missense	probably damaging	0.97
R7149:Rapgef1	UTSW	2	29720700	missense	probably damaging	0.98
R7253:Rapgef1	UTSW	2	29699721	missense	possibly damaging	0.72
R7315:Rapgef1	UTSW	2	29734492	missense	probably damaging	0.98
R7956:Rapgef1	UTSW	2	29699015	missense	probably benign	0.03
R8161:Rapgef1	UTSW	2	29679198	missense	probably benign	0.08
R8162:Rapgef1	UTSW	2	29735999	missense	probably damaging	0.99
R8372:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
RF005:Rapgef1	UTSW	2	29707195	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCGCAGTATTAGTTAGTCCAC -3'
(R):5'- GGAAGCAAGTACTCTGATCCC -3'

Sequencing Primer
(F):5'- AGTTAGTCCACATCTATACTGCCTG -3'
(R):5'- GAAGCAAGTACTCTGATCCCTTCCG -3'

Posted On

2020-09-02