Incidental Mutation 'R8373:Pla2g4d'
ID 646529
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120265595-120289197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120277499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 310 (V310M)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably null
Transcript: ENSMUST00000094665
AA Change: V310M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: V310M

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120284136 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8737:Pla2g4d UTSW 2 120269985 missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120268767 critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120269961 missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120269972 missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120268897 missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120277471 missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGCTGACTGAGGGTC -3'
(R):5'- AGACATCAACTCTGTGGGAAC -3'

Sequencing Primer
(F):5'- GGTCAACCCTCAGCCCAG -3'
(R):5'- AGGGGTGCTATGCATAGGG -3'
Posted On 2020-09-02