Incidental Mutation 'R8373:Gm14025'
ID646530
Institutional Source Beutler Lab
Gene Symbol Gm14025
Ensembl Gene ENSMUSG00000079051
Gene Namepredicted gene 14025
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129025073-129048172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129038171 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 612 (I612F)
Ref Sequence ENSEMBL: ENSMUSP00000123404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145798]
Predicted Effect
SMART Domains Protein: ENSMUSP00000123404
Gene: ENSMUSG00000079051
AA Change: I612F

DomainStartEndE-ValueType
Pfam:Vinculin 14 248 5.8e-18 PFAM
Pfam:Vinculin 281 619 2.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Gm14025
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gm14025 APN 2 129038702 missense probably benign 0.01
IGL02423:Gm14025 APN 2 129048048 missense probably benign 0.03
IGL02730:Gm14025 APN 2 129038726 missense possibly damaging 0.57
PIT4677001:Gm14025 UTSW 2 129038716 missense
R0019:Gm14025 UTSW 2 129039026 missense probably benign 0.26
R3946:Gm14025 UTSW 2 129039601 missense probably damaging 1.00
R4666:Gm14025 UTSW 2 129038230 missense probably benign 0.02
R4819:Gm14025 UTSW 2 129040801 missense probably damaging 0.96
R5634:Gm14025 UTSW 2 129039486 missense probably benign
R6019:Gm14025 UTSW 2 129037690 missense probably benign
R6241:Gm14025 UTSW 2 129037381 missense possibly damaging 0.87
R6285:Gm14025 UTSW 2 129037799 missense possibly damaging 0.82
R6377:Gm14025 UTSW 2 129036811 missense unknown
R6464:Gm14025 UTSW 2 129039545 missense possibly damaging 0.85
R6724:Gm14025 UTSW 2 129038056 missense probably benign 0.23
R7050:Gm14025 UTSW 2 129027971 splice site probably null
R7130:Gm14025 UTSW 2 129039181 missense
R7199:Gm14025 UTSW 2 129038318 missense
R7324:Gm14025 UTSW 2 129037852 missense unknown
R7355:Gm14025 UTSW 2 129037229 missense unknown
R7407:Gm14025 UTSW 2 129038809 missense
R7634:Gm14025 UTSW 2 129038272 missense
R7688:Gm14025 UTSW 2 129039044 nonsense probably null
R7889:Gm14025 UTSW 2 129036994 missense unknown
R7894:Gm14025 UTSW 2 129037129 missense unknown
R8242:Gm14025 UTSW 2 129039393 nonsense probably null
RF002:Gm14025 UTSW 2 129038794 missense
X0066:Gm14025 UTSW 2 129039067 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTGACACCTTTGCTGACAGC -3'
(R):5'- AGTCGTGGTTCAACAGCTGG -3'

Sequencing Primer
(F):5'- AATCTCCACCCATGTATGCAGGTG -3'
(R):5'- TGGCACAGTCTTCCGTGAC -3'
Posted On2020-09-02