Incidental Mutation 'R8373:Armc1'
ID 646532
Institutional Source Beutler Lab
Gene Symbol Armc1
Ensembl Gene ENSMUSG00000027599
Gene Name armadillo repeat containing 1
Synonyms Arcp, 2310016N05Rik, 2900046P06Rik, C330014L16Rik, 3110009G21Rik
MMRRC Submission 067741-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 19185566-19217229 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19203731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 65 (Y65C)
Ref Sequence ENSEMBL: ENSMUSP00000029125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029125]
AlphaFold Q9D7A8
Predicted Effect probably damaging
Transcript: ENSMUST00000029125
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029125
Gene: ENSMUSG00000027599
AA Change: Y65C

DomainStartEndE-ValueType
Pfam:Arm 27 68 1.1e-6 PFAM
SCOP:d1fvqa_ 142 203 6e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,343,078 (GRCm39) T290A probably benign Het
Aff4 C T 11: 53,291,094 (GRCm39) Q685* probably null Het
Ankmy1 A G 1: 92,823,816 (GRCm39) M150T probably damaging Het
Armc8 A G 9: 99,409,152 (GRCm39) V222A probably benign Het
Bcar1 A T 8: 112,442,370 (GRCm39) Y228* probably null Het
Cct2 T C 10: 116,896,729 (GRCm39) D158G possibly damaging Het
Cul1 T A 6: 47,491,997 (GRCm39) C426S possibly damaging Het
Deup1 G T 9: 15,503,671 (GRCm39) L297M possibly damaging Het
Dpp10 A G 1: 123,781,958 (GRCm39) S74P possibly damaging Het
Epha4 A G 1: 77,483,716 (GRCm39) Y98H possibly damaging Het
Epn3 T G 11: 94,383,762 (GRCm39) D296A probably damaging Het
Eri2 A C 7: 119,371,820 (GRCm39) I252S probably benign Het
Gp9 C T 6: 87,755,994 (GRCm39) T3I probably benign Het
H2-Q5 T A 17: 35,613,432 (GRCm39) V55E Het
Kif3c G T 12: 3,416,089 (GRCm39) V37L probably benign Het
Lct A T 1: 128,231,577 (GRCm39) N757K probably damaging Het
Lhx8 A C 3: 154,030,295 (GRCm39) N112K probably damaging Het
Loxl3 T A 6: 83,025,872 (GRCm39) S373R possibly damaging Het
Mettl4 G A 17: 95,041,077 (GRCm39) T359I probably damaging Het
Mpp7 A G 18: 7,444,096 (GRCm39) S109P probably damaging Het
Nckap5 A G 1: 125,954,032 (GRCm39) V840A probably benign Het
Ncoa4 T A 14: 31,898,893 (GRCm39) L571Q probably damaging Het
Or13a18 A T 7: 140,190,208 (GRCm39) Y35F possibly damaging Het
Or2f1 T C 6: 42,721,280 (GRCm39) F103S probably damaging Het
Phgdh G A 3: 98,228,561 (GRCm39) T204I probably damaging Het
Pla2g4d C T 2: 120,107,980 (GRCm39) V310M probably null Het
Prss3b T G 6: 41,008,622 (GRCm39) T231P possibly damaging Het
Psmd12 C T 11: 107,388,450 (GRCm39) P421L probably damaging Het
Ptch1 A G 13: 63,688,982 (GRCm39) Y432H probably damaging Het
Rapgef1 G A 2: 29,600,243 (GRCm39) G655S probably damaging Het
Rilpl2 C A 5: 124,616,097 (GRCm39) A18S probably damaging Het
Srsf7 T C 17: 80,512,815 (GRCm39) R88G probably benign Het
St6galnac1 T C 11: 116,660,059 (GRCm39) K85E possibly damaging Het
Trip12 A T 1: 84,773,488 (GRCm39) S49R probably damaging Het
Vinac1 T A 2: 128,880,091 (GRCm39) I612F Het
Wdr48 A G 9: 119,734,560 (GRCm39) T160A probably damaging Het
Zfp704 G A 3: 9,674,502 (GRCm39) T93M unknown Het
Other mutations in Armc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Armc1 APN 3 19,198,584 (GRCm39) missense probably benign 0.21
IGL01453:Armc1 APN 3 19,198,594 (GRCm39) missense probably benign 0.03
IGL02012:Armc1 APN 3 19,211,701 (GRCm39) missense possibly damaging 0.57
IGL02586:Armc1 APN 3 19,188,192 (GRCm39) utr 3 prime probably benign
R0512:Armc1 UTSW 3 19,203,659 (GRCm39) missense possibly damaging 0.87
R1694:Armc1 UTSW 3 19,189,050 (GRCm39) missense possibly damaging 0.81
R1878:Armc1 UTSW 3 19,211,708 (GRCm39) missense probably damaging 1.00
R1881:Armc1 UTSW 3 19,189,060 (GRCm39) missense possibly damaging 0.76
R2191:Armc1 UTSW 3 19,188,225 (GRCm39) missense probably damaging 1.00
R2264:Armc1 UTSW 3 19,189,033 (GRCm39) missense probably damaging 1.00
R2403:Armc1 UTSW 3 19,211,840 (GRCm39) start gained probably benign
R2969:Armc1 UTSW 3 19,189,024 (GRCm39) missense probably benign
R3861:Armc1 UTSW 3 19,189,196 (GRCm39) missense probably damaging 1.00
R4296:Armc1 UTSW 3 19,203,680 (GRCm39) missense probably damaging 0.99
R6753:Armc1 UTSW 3 19,198,562 (GRCm39) missense possibly damaging 0.86
R6891:Armc1 UTSW 3 19,189,205 (GRCm39) missense probably damaging 1.00
R7837:Armc1 UTSW 3 19,198,633 (GRCm39) missense probably benign 0.01
R8743:Armc1 UTSW 3 19,211,700 (GRCm39) missense probably benign 0.19
Z1088:Armc1 UTSW 3 19,203,671 (GRCm39) missense probably damaging 1.00
Z1177:Armc1 UTSW 3 19,203,738 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTGGACATAAAACCTACAGAAGCC -3'
(R):5'- CCCTAGGAGGTTACTTTGAACG -3'

Sequencing Primer
(F):5'- GCTACTGACACACTGTCT -3'
(R):5'- CTAGGAGGTTACTTTGAACGACACAG -3'
Posted On 2020-09-02