Incidental Mutation 'R8373:Lhx8'
ID646534
Institutional Source Beutler Lab
Gene Symbol Lhx8
Ensembl Gene ENSMUSG00000096225
Gene NameLIM homeobox protein 8
SynonymsL3, Lhx7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location154306294-154330659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 154324658 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 112 (N112K)
Ref Sequence ENSEMBL: ENSMUSP00000136047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177846] [ENSMUST00000204171] [ENSMUST00000204403] [ENSMUST00000205251]
Predicted Effect probably damaging
Transcript: ENSMUST00000177846
AA Change: N112K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136047
Gene: ENSMUSG00000096225
AA Change: N112K

DomainStartEndE-ValueType
low complexity region 67 87 N/A INTRINSIC
LIM 95 148 2.38e-12 SMART
LIM 156 210 2.06e-16 SMART
HOX 246 308 2.7e-23 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204171
SMART Domains Protein: ENSMUSP00000144708
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 11 31 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204403
AA Change: N81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145516
Gene: ENSMUSG00000096225
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205251
AA Change: N81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145485
Gene: ENSMUSG00000096225
AA Change: N81K

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice exhibit partial penetrance of a cleft secondary palate and neonatal lethality; those without cleft palate survive to adulthood. All homozygous null mice have decreased or absent forebrain cholinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Lhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Lhx8 APN 3 154322355 missense probably damaging 1.00
IGL01991:Lhx8 APN 3 154324554 missense probably damaging 1.00
R0463:Lhx8 UTSW 3 154328171 splice site probably null
R1449:Lhx8 UTSW 3 154328105 nonsense probably null
R1837:Lhx8 UTSW 3 154328055 missense possibly damaging 0.94
R2272:Lhx8 UTSW 3 154316762 missense probably damaging 1.00
R3196:Lhx8 UTSW 3 154330288 missense probably benign 0.05
R4900:Lhx8 UTSW 3 154330288 missense probably benign 0.01
R5120:Lhx8 UTSW 3 154311695 missense probably damaging 0.99
R5223:Lhx8 UTSW 3 154321644 missense probably damaging 1.00
R5587:Lhx8 UTSW 3 154311679 missense probably damaging 0.99
R6046:Lhx8 UTSW 3 154321703 missense probably damaging 1.00
R7155:Lhx8 UTSW 3 154324584 missense possibly damaging 0.82
R7800:Lhx8 UTSW 3 154321647 missense probably damaging 1.00
R7834:Lhx8 UTSW 3 154311537 missense probably null 0.00
R8039:Lhx8 UTSW 3 154306939 missense probably damaging 0.98
R8768:Lhx8 UTSW 3 154322249 missense possibly damaging 0.80
X0028:Lhx8 UTSW 3 154324575 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGTGCAAAAGGCCCTGTTAC -3'
(R):5'- TCAGGTTTTCTCAGAGAGGAAGGG -3'

Sequencing Primer
(F):5'- TGCAAAAGGCCCTGTTACAAAAGTC -3'
(R):5'- TATGGAAGAAAACCCAAATCCTTC -3'
Posted On2020-09-02