Incidental Mutation 'R8373:2210010C04Rik'
ID 646536
Institutional Source Beutler Lab
Gene Symbol 2210010C04Rik
Ensembl Gene ENSMUSG00000029882
Gene Name RIKEN cDNA 2210010C04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8373 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 41030268-41035509 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 41031688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 231 (T231P)
Ref Sequence ENSEMBL: ENSMUSP00000031931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031931]
AlphaFold Q9CPN9
Predicted Effect possibly damaging
Transcript: ENSMUST00000031931
AA Change: T231P

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031931
Gene: ENSMUSG00000029882
AA Change: T231P

DomainStartEndE-ValueType
Tryp_SPc 24 240 3.52e-102 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr453 T C 6: 42,744,346 F103S probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in 2210010C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:2210010C04Rik APN 6 41031673 missense probably damaging 1.00
IGL01625:2210010C04Rik APN 6 41032948 missense probably benign 0.01
IGL02159:2210010C04Rik APN 6 41032957 missense probably benign 0.34
IGL03161:2210010C04Rik APN 6 41034306 missense probably damaging 0.96
R0419:2210010C04Rik UTSW 6 41034347 missense probably benign 0.05
R1715:2210010C04Rik UTSW 6 41032936 splice site probably null
R2057:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2059:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2136:2210010C04Rik UTSW 6 41035462 missense probably benign 0.28
R2446:2210010C04Rik UTSW 6 41031648 missense probably benign 0.15
R4862:2210010C04Rik UTSW 6 41032411 missense possibly damaging 0.74
R5068:2210010C04Rik UTSW 6 41032436 missense probably benign 0.35
R5369:2210010C04Rik UTSW 6 41033006 missense probably benign 0.00
R6392:2210010C04Rik UTSW 6 41032372 missense probably damaging 1.00
R7010:2210010C04Rik UTSW 6 41032313 missense probably benign 0.42
R7567:2210010C04Rik UTSW 6 41033193 missense probably benign 0.04
R7727:2210010C04Rik UTSW 6 41033193 missense probably benign 0.04
R7962:2210010C04Rik UTSW 6 41035453 missense probably benign 0.01
R8529:2210010C04Rik UTSW 6 41032435 missense probably benign 0.00
R8883:2210010C04Rik UTSW 6 41032371 nonsense probably null
R8916:2210010C04Rik UTSW 6 41033169 missense probably damaging 1.00
R9066:2210010C04Rik UTSW 6 41031706 missense probably benign 0.41
R9095:2210010C04Rik UTSW 6 41033104 missense possibly damaging 0.76
R9180:2210010C04Rik UTSW 6 41031747 missense probably damaging 1.00
R9389:2210010C04Rik UTSW 6 41033145 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCAGCAATTTCAAGAGAAAGTTC -3'
(R):5'- ACCTACAAAAGTGGCCCGAG -3'

Sequencing Primer
(F):5'- GTTCGTTATTATGCAAGAACCATTC -3'
(R):5'- TGGCCCGAGATAATCAAGTAAC -3'
Posted On 2020-09-02