Incidental Mutation 'R8373:Olfr453'
ID646537
Institutional Source Beutler Lab
Gene Symbol Olfr453
Ensembl Gene ENSMUSG00000095831
Gene Nameolfactory receptor 453
SynonymsMOR257-8P, GA_x6K02T2P3E9-4815856-4814903
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R8373 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42739371-42746963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42744346 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 103 (F103S)
Ref Sequence ENSEMBL: ENSMUSP00000150467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053647] [ENSMUST00000213997]
Predicted Effect probably damaging
Transcript: ENSMUST00000053647
AA Change: F103S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052043
Gene: ENSMUSG00000095831
AA Change: F103S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-54 PFAM
Pfam:7tm_1 41 290 1.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213997
AA Change: F103S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,031,688 T231P possibly damaging Het
Adgrg6 T C 10: 14,467,334 T290A probably benign Het
Aff4 C T 11: 53,400,267 Q685* probably null Het
Ankmy1 A G 1: 92,896,094 M150T probably damaging Het
Armc1 T C 3: 19,149,567 Y65C probably damaging Het
Armc8 A G 9: 99,527,099 V222A probably benign Het
Bcar1 A T 8: 111,715,738 Y228* probably null Het
Cct2 T C 10: 117,060,824 D158G possibly damaging Het
Cul1 T A 6: 47,515,063 C426S possibly damaging Het
Deup1 G T 9: 15,592,375 L297M possibly damaging Het
Dpp10 A G 1: 123,854,229 S74P possibly damaging Het
Epha4 A G 1: 77,507,079 Y98H possibly damaging Het
Epn3 T G 11: 94,492,936 D296A probably damaging Het
Eri2 A C 7: 119,772,597 I252S probably benign Het
Gm14025 T A 2: 129,038,171 I612F Het
Gp9 C T 6: 87,779,012 T3I probably benign Het
H2-Q5 T A 17: 35,394,456 V55E Het
Kif3c G T 12: 3,366,089 V37L probably benign Het
Lct A T 1: 128,303,840 N757K probably damaging Het
Lhx8 A C 3: 154,324,658 N112K probably damaging Het
Loxl3 T A 6: 83,048,891 S373R possibly damaging Het
Mettl4 G A 17: 94,733,649 T359I probably damaging Het
Mpp7 A G 18: 7,444,096 S109P probably damaging Het
Nckap5 A G 1: 126,026,295 V840A probably benign Het
Ncoa4 T A 14: 32,176,936 L571Q probably damaging Het
Olfr46 A T 7: 140,610,295 Y35F possibly damaging Het
Phgdh G A 3: 98,321,245 T204I probably damaging Het
Pla2g4d C T 2: 120,277,499 V310M probably null Het
Psmd12 C T 11: 107,497,624 P421L probably damaging Het
Ptch1 A G 13: 63,541,168 Y432H probably damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rilpl2 C A 5: 124,478,034 A18S probably damaging Het
Srsf7 T C 17: 80,205,386 R88G probably benign Het
St6galnac1 T C 11: 116,769,233 K85E possibly damaging Het
Trip12 A T 1: 84,795,767 S49R probably damaging Het
Wdr48 A G 9: 119,905,494 T160A probably damaging Het
Zfp704 G A 3: 9,609,442 T93M unknown Het
Other mutations in Olfr453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr453 APN 6 42744691 missense probably damaging 1.00
IGL01642:Olfr453 APN 6 42744552 missense probably benign 0.00
IGL02703:Olfr453 APN 6 42744076 missense possibly damaging 0.90
IGL03018:Olfr453 APN 6 42744814 missense probably damaging 1.00
R1163:Olfr453 UTSW 6 42744123 missense probably benign 0.00
R1728:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1729:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1730:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1739:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1784:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2014:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2015:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2130:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2132:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2133:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R3937:Olfr453 UTSW 6 42744076 missense probably damaging 0.98
R4862:Olfr453 UTSW 6 42744555 missense possibly damaging 0.65
R4959:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R4973:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R5155:Olfr453 UTSW 6 42744814 missense probably damaging 1.00
R6581:Olfr453 UTSW 6 42744079 missense probably damaging 1.00
R7028:Olfr453 UTSW 6 42744403 missense probably benign 0.08
R7348:Olfr453 UTSW 6 42744856 missense possibly damaging 0.95
R7490:Olfr453 UTSW 6 42744805 missense probably damaging 1.00
R7522:Olfr453 UTSW 6 42744634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATCAGACTGGACAGCAG -3'
(R):5'- AGCAGCTCGCAGGATATATG -3'

Sequencing Primer
(F):5'- GATCAGACTGGACAGCAGACTCC -3'
(R):5'- TACACGTTCGTGCACATGG -3'
Posted On2020-09-02